WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00032329 Gene Name  Cbr-snt-1
Sequence Name  ? CBG11160 Organism  Caenorhabditis briggsae
Automated Description  Predicted to be located in membrane. Is an ortholog of C. elegans snt-1. In C. elegans, snt-1 is involved in several processes, including defecation; regulation of nematode pharyngeal pumping; and synaptic vesicle endocytosis. Biotype  SO:0001217
Genetic Position 
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis briggsae 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CBG11160.1 CBG11160.1   [unknown]
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CBG11160 CBG11160   [unknown]

0 RNAi Result

1 Allele

Public Name
WBVar00012837

0 Chromosome

0 Chromosome Location

2 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Cbr-snt-1, CCCAATGGCACACTCTCGGACCAGTCGAGGAAGAAGGTGATAAGAAGGACGAGAAGAAAT, WBGene00032329   Expr1052847 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

1 GO Annotation

Annotation Extension Qualifier
  located_in

0 Homologues

0 Locations

1 Ontology Annotations

Annotation Extension Qualifier
  located_in

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term