WormMine: Gene WBGene00032611

• WormBase Gene ID: WBGene00032611
• Gene Name: CBG11501
• Sequence Name: CBG11501
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable calcium ion binding activity. Is an ortholog of C. elegans T01D3.6.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG11501a.1	CBG11501a.1		[unknown]
Transcript:CBG11501b.1	CBG11501b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG11501b	CBG11501b		[unknown]
CDS:CBG11501a	CBG11501a		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1065628
• Remark: CBG11501, ATCGCACAATCGTCGATGTACTTGCGTCCAGTTGGATATCCAAGATATGACACTCTATAA, WBGene00032611
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term