WormMine: Gene WBGene00042600

• WormBase Gene ID: WBGene00042600
• Gene Name: CBG24505
• Sequence Name: CBG24505
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable ABC-type transporter activity and ATP binding activity. Predicted to be involved in transmembrane transport. Predicted to be located in membrane. Is an ortholog of C. elegans C06G4.4.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24505.1	CBG24505.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24505	CBG24505		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1053329
• Remark: CBG24505, ATTCGAAGCAAGGAACTGGCGCTGATCAAGAAGAGTGCAATGGTCAGGAACATCCTGGAC, WBGene00042600
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

4 GO Annotation

0 Homologues

0 Locations

4 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term