WormMine: Gene WBGene00042782

• WormBase Gene ID: WBGene00042782
• Gene Name: Cbr-kat-1
• Sequence Name: CBG24741
• Organism: Caenorhabditis briggsae
• Automated Description: Predicted to enable acyltransferase activity, transferring groups other than amino-acyl groups. Is an ortholog of C. elegans kat-1.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis briggsae
• Taxon Id: 6238

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CBG24741.1	CBG24741.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CBG24741	CBG24741		[unknown]

0 RNAi Result

1 Allele

• WBVar00005579

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

1 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in Cbr-spr-4(gu163) comparing to in AF16.	DESeq2, FDR < 0.05.	WBPaper00059178:Cbr-spr-4(gu163)_downregulated

1 Expression Patterns

• Primary Identifier: Expr1057274
• Remark: Cbr-kat-1, TGTAGCTCAATGGGAGGTCAATGAAGCATTCTCATGCGTTCCTCTTGCATTCATCAAGAA, WBGene00042782
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

2 GO Annotation

0 Homologues

0 Locations

2 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term