WormMine: Gene WBGene00060983

• WormBase Gene ID: WBGene00060983
• Gene Name: Cre-wwp-1
• Sequence Name: CRE20808
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to enable ubiquitin protein ligase activity. Predicted to be involved in ubiquitin-dependent protein catabolic process. Is an ortholog of C. elegans wwp-1. In C. elegans, wwp-1 is involved in defense response to bacterium; protein ubiquitination; and regulation of protein catabolic process.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE20808.1	CRE20808.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE20808	CRE20808		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1093127
• Remark: Cre-wwp-1, TCGAACTGCTGCTCTGTGGAATGCAAGATGTAGATGTTGATGATTGGCAAAGAAATACTG, WBGene00060983
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

3 GO Annotation

0 Homologues

0 Locations

3 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term