WormMine: Gene WBGene00073869

• WormBase Gene ID: WBGene00073869
• Gene Name: CRE15185
• Sequence Name: CRE15185
• Organism: Caenorhabditis remanei
• Automated Description: Predicted to be involved in cilium assembly. Is an ortholog of C. elegans daf-10. In C. elegans, daf-10 is involved in several processes, including non-motile cilium assembly; positive regulation of dauer larval development; and receptor localization to non-motile cilium.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis remanei
• Taxon Id: 31234

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CRE15185.1	CRE15185.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CRE15185	CRE15185		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1113122
• Remark: CRE15185, TTTGAACCACACTGTATTAAGTACTGTATTCAAGGAGAATATTTGTTGATTGGAGGGTCG, WBGene00073869
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term