WormMine: Gene WBGene00133939

• WormBase Gene ID: WBGene00133939
• Gene Name: CJA14735
• Sequence Name: CJA14735
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to be located in nucleus. Is an ortholog of C. elegans hpl-1 and hpl-2. In C. elegans, hpl-1 is involved in several processes, including developmental process involved in reproduction; negative regulation of Ras protein signal transduction; and negative regulation of vulval development.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA14735.1	CJA14735.1		[unknown]

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA14735	CJA14735		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074490
• Remark: Cjp-hpl-1, GACCGCGTAATCAGATTCTACGAGTCTCGGCTTGCACTCGAAGATGTTGATATTCAGTAA, WBGene00133939
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

1 GO Annotation

0 Homologues

0 Locations

1 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term