WormMine: Gene WBGene00135222

• WormBase Gene ID: WBGene00135222
• Gene Name: CJA16018
• Sequence Name: CJA16018
• Organism: Caenorhabditis japonica
• Automated Description: Predicted to enable DNA binding activity; DNA ligase (ATP) activity; and zinc ion binding activity. Predicted to be involved in DNA recombination and DNA repair. Is an ortholog of C. elegans K07C5.3.
• Biotype: SO:0001217
• Genetic Position: :±

1 Organism

• Name: Caenorhabditis japonica
• Taxon Id: 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:CJA16018a.1	CJA16018a.1		[unknown]
Transcript:CJA16018b.1	CJA16018b.1		[unknown]

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:CJA16018a	CJA16018a		[unknown]
CDS:CJA16018b	CJA16018b		[unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

2 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

• Primary Identifier: Expr1074502
• Remark: CJA16018, CATTCGAGAGGCTGATAAACGAGAGTATCACATCACGGATGAGCAGCTTATCAGCCATTT, WBGene00135222
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

5 GO Annotation

0 Homologues

0 Locations

5 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term