WormMine: Gene WBGene00005069

• WormBase Gene ID: WBGene00005069
• Gene Name: srb-4
• Sequence Name: C27D6.7
• Organism: Caenorhabditis elegans
• Automated Description: Is affected by hmg-4; let-418; and dcp-66 based on RNA-seq studies. Is affected by resveratrol and Sirolimus based on microarray studies.
• Biotype: SO:0000336
• Genetic Position: II :-1.96572 ±0.002399
• Length (nt): 1153

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00005069

Genomics

0 Transcripts

Other

0 CDSs

0 RNAi Result

13 Allele

• gk963801
• gk963053
• WBVar01372522
• WBVar01825438
• gk142346
• gk142345
• gk663092
• gk462651
• gk791613
• WBVar00223591
• gk142347
• WBVar00171883
• cxTi512

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00005069
• Start: 5163868
• End: 5165020
• Strand: -1

2 Data Sets

• WormBaseAcedbConverter
• C. elegans genomic annotations (GFF3 Gene)

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_5163384..5163867
• Length (nt): 484
• Chromosome Location: II: 5163384-5163867
• Organism: Caenorhabditis elegans

8 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_12
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Genes expressed in embryonic motor neurons (identified by unc-4::GFP expressing cells).	Genes called Present by MAS 5.0 in 2 out of 3 unc-4::GFP hybridizations.	WBPaper00025141:unc-4::GFP_Expressed_Genes
	Genes found to be regulated in daf-16(mgDf50) by resveratrol treatment with p < 0.01.	N.A.	WBPaper00026929:Resveratrol_regulated_daf-16
	Genes from eat-2(ad465) animals with significantly increased expression after 72 hours of treatment on growth media with 10uM rapamycin in 2% DMSO.	Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes.	WBPaper00048989:eat-2(ad465)_rapamycin_upregulated
	Transcripts that showed significantly increased expression in let-418(n3536);dcp-66(RNAi) comparing to control.	DESeq, fold change > 2.	WBPaper00062672:let-418(n3536)dcp-66(RNAi)_upregulated
	Coexpression clique No. 211, srj-42-srw-113, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:srj-42-srw-113
	Transcripts that showed significantly decreased expression in hmg-4(RNAi) comparing to in vector control worm at L4 larva stage.	DESeq 2, fold change > 4, adjusted p-value < 0.05.	WBPaper00055013:hmg-4(RNAi)_downregulated

3 Expression Patterns

• Primary Identifier: Expr5358
• Remark: Strain: BC11974
• Reporter Gene: [srb-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGGGATTCTGTGTCAAGTAGAA] 3' and primer B 5' [AAAACATTTGGAAAAATTTGAGA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Expr5359
• Remark: Strain: BC12935
• Reporter Gene: [srb-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGGGATTCTGTGTCAAGTAGAA] 3' and primer B 5' [AAAACATTTGGAAAAATTTGAGA] 3'.
• Pattern: Adult Expression: intestine; Larval Expression: intestine

• Primary Identifier: Chronogram1290
• Remark: Original chronogram file: chronogram.241.xml
• Reporter Gene: [C27D6.7:gfp] transcriptional fusion.

0 GO Annotation

0 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00005069
• Start: 5163868
• End: 5165020
• Strand: -1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 1153

1 Sequence Ontology Term