WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005075 Gene Name  srb-10
Sequence Name  ? F23F12.11 Organism  Caenorhabditis elegans
Automated Description  Is affected by sir-2.1 and ain-1 based on microarray studies. Is affected by four chemicals including resveratrol; Chlorpyrifos; and Diazinon based on microarray studies. Biotype  SO:0000336
Genetic Position  III :-1.16863 ±0.004117 Length (nt)  ? 1229
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005075

Genomics

0 Transcripts

 

Other

0 CDSs

0 RNAi Result

17 Allele

Public Name
gk964518
gk176702
gk176703
gk176704
gk964032
gk964033
gk963895
WBVar01264413
h16148
h7790
WBVar01837676
gk737749
gk809737
gk674514
WBVar01396896
WBVar00057200
WBVar01628606

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005075 6493553 6494781 1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_6494782..6495672   891 III: 6494782-6495672 Caenorhabditis elegans

10 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts that showed significantly altered expression after 24 hour exposure to nitroguanidine (NQ). Multivariate permutation tests with random variance model implemented in BRB-Array Tools version 4.5 were performed to infer differentially expressed genes (DEGs). One thousand random permutations were computed per chemical class (i.e., a group of 16 arrays or samples). The confidence level of false discovery rate assessment was set at 80%, and the maximum allowed portion of false-positive genes was 10%. WBPaper00055899:nitroguanidine_regulated
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Genes found to be regulated in daf-16(mgDf50) by resveratrol treatment with p < 0.01. N.A. WBPaper00026929:Resveratrol_regulated_daf-16
  Genes with differential expression under 0.5mg/l Chlorpyrifos (CPF) and 0.5mg/l Diazinon (DZN) treatment at 24 centigrade. To identify the differentially expressed genes in each treatment authors used linear models per toxicant and temperature (gene expression = Toxicant (effect) + error). The lm function in R stats package was used to implement the linear models analysis with recommended default options. For threshold determination authors used a permutation approach. For each of the 23,232 permutations used authors randomly picked a transcript (array spot), which could only be picked once. Authors combined all the expression values of this transcript and randomly distributed them over the replicates and used them in the linear model. In this way authors obtained a threshold for each of the toxicants. Authors used a -log10 p-value 2 as common threshold for the analysis, which resembles to the following FDR per toxicant: 0.0155 for CPF at 24 centigrade, 0.0148 for DZN at 24 centigrade, 0.0168 for CPF+DZN at 24 centigrade, 0.0142 for CPF at 16 centigrade, 0.0151 for DZN at 16 centigrade, and 0.0148 for CPF+DZN, at 16 centigrade. WBPaper00040210:Chlorpyrifos_Diazinon_24C_regulated
  mRNAs that were significantly enriched in the AIN-1 immunoprecipitation samples, compared to the control total mRNAs in the input extracts (p < 0.01). Signals from replicates of total worm lysates from wt and strains containing the ain-2::gfp or the ain-2 promoter::gfp transgene were mean normalized and averaged respectively to generate standard profiles of gene expression in these worm strains. Authors then calculated the ratio of signal of each gene from each IP sample to the standard gene expression profile of the corresponding worm strain. Based on this ratio, a percentile rank of each gene relative to all genes in each IP replicate was calculated. The percentile ranks in the three replicates of each IP were averaged. Student t test was utilized to determine if the average percentile ranks of enrichment of individual genes were significantly higher (p value) than the mean enrichment of all genes in the IP samples. To determine the AIN-1 or AIN-2 associated genes, we used the following criteria: (1) average percentile ranks of enrichment is greater than the mean enrichment of all genes in AIN-1 or AIN-2 IP with p < 0.01; (2) average signal in AIN-1 or AIN-2 IP replicates is greater than the background signal (including 2X standard deviation (SD)) (Background signal and SD were calculated based on signals from empty spots on each microarray); (3) criteria 1 is not be satisfied for the same gene in the corresponding control IP. WBPaper00031252:AIN-1_IP_enriched
  Coexpression clique No. 211, srj-42-srw-113, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-42-srw-113
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_21
  hermaphrodite soma-enriched Comparisons were made between genotypes by subtracting the mean log value of one ratio from another, and the significance of the difference was evaluated using Student t-test for two populations. For the fem-3(gf) versus fem-1(lf) direct comparison, authors performed the same analysis, except they used a Students t-test for one population. Author chose a combination of a twofold difference with a t value exceeding 99% confidence (P < 0.01), because these criteria allowed the inclusion of essentially all genes that had previously been identified as germline-enriched in a wt/glp-4 hermaphrodite comparison. Additionally, requiring a twofold difference reduced false positives, as the number of genes with two-fold difference and a P<0.01 only included ~100 genes more than with P < 0.001, and almost all genes showed germline expression by in situ hybridization. [cgc6390]:herm_soma-enriched
  C-lineage related expression profile. QT clustering WBPaper00025032:cluster_83

2 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC14816 [srb-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCGAACGTTCAAAATCTTCATA] 3' and primer B 5' [ATCATCGTTGATTTTCGGA] 3'. Expr5839 Adult Expression: intestine; Nervous System; head neurons; tail neurons; Larval Expression: intestine; Nervous System; head neurons; tail neurons;  
    Expr14022 2 head neuron pairs? (dim and variable)  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005075 6493553 6494781 1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
1229

1 Sequence Ontology Term