WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00018136 Gene Name  F37A4.6
Sequence Name  ? F37A4.6 Organism  Caenorhabditis elegans
Automated Description  Enriched in germ line; intestine; and neurons based on Chronogram; RNA-seq; single-cell RNA-seq; proteomic; and microarray studies. Is affected by several genes including mut-2; mter-4; and etr-1 based on RNA-seq and microarray studies. Is affected by Colistin based on microarray studies. Biotype  SO:0001217
Genetic Position  Length (nt)  ? 1384
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00018136

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F37A4.6.1 F37A4.6.1 1170   III: 6705815-6707198
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F37A4.6 F37A4.6 1170   III: 6705815-6706000

20 RNAi Result

WormBase ID
WBRNAi00046563
WBRNAi00046564
WBRNAi00046565
WBRNAi00074301
WBRNAi00074300
WBRNAi00074303
WBRNAi00074305
WBRNAi00074304
WBRNAi00074307
WBRNAi00074306
WBRNAi00072470
WBRNAi00014467
WBRNAi00072471
WBRNAi00072472
WBRNAi00005586
WBRNAi00007160
WBRNAi00031895
WBRNAi00031897
WBRNAi00074302
WBRNAi00002495

20 Allele

Public Name
gk964518
gk964032
gk964033
WBVar01264625
WBVar01264627
WBVar01264626
WBVar01656932
WBVar01446254
WBVar01446253
gk788975
WBVar00062527
gk460920
gk879091
WBVar00062532
gk852891
gk510194
gk684831
gk510193
gk469265
gk177071

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00018136 6705815 6707198 1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

78 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_Food
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_oocyte_depleted
  Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain. RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis. WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage. DESeq2, fold change > 2 WBPaper00058725:sftb-1(cer6)_upregulated
  Transcripts depleted in RIS neurons comparing to in all cells. edgeR 3.24.3, FDR < 0.01 WBPaper00058969:RIS_depleted
20C vs 25C Transcripts that showed differential expression in 20C vs 25C in N2 animals at adult stage. N.A. WBPaper00050488:20C_vs_25C_regulated_N2_adult
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
Hypoxia: 7% oxygen. Transcripts that showed significantly increased expression at animals treated with 7% oxygen, comparing to animals grown at 21% oxygen. Fold change > 2, p-value < 0.05. WBPaper00060661:hypoxia_upregulated
Fungi infection: Drechmeria coniospora. 24 hours of infection. Genes that showed increased expression after 24 hours of infection by fungi Drechmeria coniospora. Differentially regulated genes based on fold change, corresponding to the uppermost 18.75th percentile of datasets formed using genes with normalized, expression ratios (infected/control) >1.01 or <0.99 in at least ten out of fourteen arrays are shown. WBPaper00032031:DConiospora_upregulated_OligoArray_24h
control(maintained under normal lab light (mostly dark, in incubators).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h). Genes differentially expressed in control vs under EtBr treatment without UVC exposure, at the -1h timepoint. Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_EtBr-exposed_48h
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-EtBr-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total) and exposed to EtBr (5ug/mL in agar).) at just prior to the third UVC dose (48h). Genes differentially expressed in control vs after UVC exposure and EtBr treatment at the -1h timepoint (just prior to the third UVC dose (48h)). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-EtBr-exposed_48h
  Transcripts that showed significantly increased expression in ints-1(RNAi) animals comparing to control RNAi animals, at late L3 larva stage. DESeq2, v1.12.0, fold change > 2, FDR < 0.05 WBPaper00057068:ints-4(RNAi)_upregulated
  Transcripts that showed significantly increased expression in pals-17(syb3980) comparing to in N2 animals at young adult stage. Differential expression analyses were performed using limma-voom in Galaxy, adj p <= 0.05, logFC > 2 WBPaper00065984:pals-17(syb3980)_upregulated
  Embryonic Pan-neural Enriched Genes. A two-class unpaired analysis of the data was performed to identify genes that differ by >= 1.5-fold from the reference at a FDR of <1% for the larval pan-neural, embryonic pan-neural, and larval A-class motor neuron datasets. WBPaper00030839:Embryo_Pan_Neuronal
  Germline-enriched and sex-biased expression profile cluster F. hierarchical clustering [cgc6390]:Cluster_F
  Transcripts that showed significantly increased expression in PLM neuron cells comparing to in whole animal, according to dissected single neuron RNASeq analysis. Fold change >= 4. WBPaper00050344:PLM-neuron_enriched
Temperature Shift: 25C vs 15C for 16 hours at L4 larva stage. Transcripts that showed significantly increased expression in AFD neurons comparing to in whole animals. DESeq2, fold change > 2, FDR < 0.05. WBPaper00065158:AFD_enriched
moderate static magnetic field Transcripts that showed significantly decreased expression after exposure to moderate static magnetic field. N.A. WBPaper00064509:static-magnetic-field_downregulated
  siRNAs that showed significantly lower expression (log2fold > 2, padj < 0.01) in hermaphrodite gonad (somatic gonad plus germine) than in male gonad (somatic gonad plus germine). DESeq2 v1.13.8, fold change > 2, FDR < 0.01. WBPaper00056161:male_enriched_siRNA
  Transcripts that showed significantly decreased expression in mter-4(syb3662 syb3403) comparing to in N2. DESeq2, fold change > 2, FDR < 0.05. WBPaper00061995:mter-4(syb3662syb3403)_downregulated
4 hours of starvation. Genes with significantly increased expression in N2 animals after 4 hours of starvation. Differentially expressed genes were determined by ANOVA analysis using the Partek software package. WBPaper00047070:N2_starvation_upregulated

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2021641 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Also expressed in (comments from author) : No comments. Strain: BC14588 [F37A4.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TACAGGTTTCCACTGGTACTTTGA] 3' and primer B 5' [TGGGCGGAGGATCATTATAG] 3'. Expr5975 Larval Expression: Nervous System; head neurons;  
    Expr1150453 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1011750 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2003427 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.872.xml [F37A4.6:gfp] transcriptional fusion. Chronogram1954    

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00018136 6705815 6707198 1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
1384

1 Sequence Ontology Term