WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005073 Gene Name  srb-8
Sequence Name  ? F37C12.15 Organism  Caenorhabditis elegans
Automated Description  Is affected by several genes including rsr-2; lin-14; and lin-4 based on tiling array; RNA-seq; and microarray studies. Is affected by five chemicals including resveratrol; Atrazine; and Chlorpyrifos based on microarray studies. Biotype  SO:0000336
Genetic Position  III :-0.777427 ±0.000157 Length (nt)  ? 1734
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005073

Genomics

0 Transcripts

 

Other

0 CDSs

0 RNAi Result

9 Allele

Public Name
gk964518
gk963887
gk963145
WBVar02122566
WBVar02121754
WBVar02120683
WBVar02122238
WBVar02124958
WBVar02120848

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005073 7171857 7173590 1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_7173591..7174072   482 III: 7173591-7174072 Caenorhabditis elegans

17 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_18
  WT-Pico Pan-neural Depleted Genes, with genes found multiple times in a single dataset removed (without dups). To identify differentially expressed transcripts, normalized intensity values from the pan-neural data sets were compared to a reference (from all larval cells) using Significance Analysis of Microarray software (SAM). A two class unpaired analysis of the data was performed to identify neuron-enriched genes. Pan-neural enriched transcripts in the IVT and WT-Pico-derived data set were defined as 1.5X elevated vs the reference at a False Discovery Rate (FDR) = 3%. WBPaper00031532:Larva_Pan_Neuronal_Depleted
EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed under EtBr treatment without UVC exposure vs after UVC exposure but without EtBr treatment at the -3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food). Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:EtBr-exposed_vs_UVC-exposed_51h
control(maintained under normal lab light (mostly dark, in incubators).) vs EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food. Genes differentially expressed in control vs under EtBr treatment without UVC exposure, at the 3h timepoint. Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_EtBr-exposed_51h
  Genes that showed significant differential expressed between control and 150 mg\/L Atrazine treatment. t-test, p < 0.05. WBPaper00036123:Atrazine_regulated
  Genes found to be regulated in daf-16(mgDf50) by resveratrol treatment with p < 0.01. N.A. WBPaper00026929:Resveratrol_regulated_daf-16
  Genes from eat-2(ad465) animals with significantly increased expression after 72 hours of treatment on growth media with 10uM rapamycin in 2% DMSO. Analysis of gene expression data was carried out with the Affymetrix Transcriptome Analysis Console. Data preprocessing (using RMA normalization) and QC metrics were performed using Affymetrix Expression Console TM and manually inspected afterwards. Expression analysis was carried out for each two pairwise conditions. FDR statistical correction for multiple testing resulted in a slightly lower number of DEGs in most cases. P-value < 0.05 and fold change > 2.0 were used to determine differentially expressed genes. WBPaper00048989:eat-2(ad465)_rapamycin_upregulated
  mRNAs that were significantly enriched in the AIN-1 immunoprecipitation samples, compared to the control total mRNAs in the input extracts (p < 0.01). Signals from replicates of total worm lysates from wt and strains containing the ain-2::gfp or the ain-2 promoter::gfp transgene were mean normalized and averaged respectively to generate standard profiles of gene expression in these worm strains. Authors then calculated the ratio of signal of each gene from each IP sample to the standard gene expression profile of the corresponding worm strain. Based on this ratio, a percentile rank of each gene relative to all genes in each IP replicate was calculated. The percentile ranks in the three replicates of each IP were averaged. Student t test was utilized to determine if the average percentile ranks of enrichment of individual genes were significantly higher (p value) than the mean enrichment of all genes in the IP samples. To determine the AIN-1 or AIN-2 associated genes, we used the following criteria: (1) average percentile ranks of enrichment is greater than the mean enrichment of all genes in AIN-1 or AIN-2 IP with p < 0.01; (2) average signal in AIN-1 or AIN-2 IP replicates is greater than the background signal (including 2X standard deviation (SD)) (Background signal and SD were calculated based on signals from empty spots on each microarray); (3) criteria 1 is not be satisfied for the same gene in the corresponding control IP. WBPaper00031252:AIN-1_IP_enriched
  Transcripts that showed significantly decreased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_downregulated_neuron
  Potental DAF-12 target genes identified by ChIP-chip analysis performed on strain ALF4 [daf-12 Affymetrix TAS software that computed for each probe estimates of fold enrichment (in linear scale) over hybridization with input DNA. At the same time, TAS calculated for each probe a p-value by applying a Wilcoxon signed rank test. A threshold of 2.5 was selected, which corresponds to probe intensities approximately 2.5 times stronger on the ChIP array than on the Input array. Additional TAS threshold parameters were MinRun=180 bp, MaxGap=300 bp. TAS analysis showed that the selected threshold of 2.5 corresponds approximately to a p-value of 0.01. WBPaper00040221:DAF-12_target_ALF4
  Genes that showed significantly decreased expression level in rsr-2(RNAi) animals comparing to in gfp(RNAi) control. Fold change > 1.2 or < 0.8. WBPaper00042477:rsr-2(RNAi)_downregulated_TilingArray
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_5
  Genes with differential expression under 0.5mg/l Chlorpyrifos (CPF) treatment at 24 centigrade. To identify the differentially expressed genes in each treatment authors used linear models per toxicant and temperature (gene expression = Toxicant (effect) + error). The lm function in R stats package was used to implement the linear models analysis with recommended default options. For threshold determination authors used a permutation approach. For each of the 23,232 permutations used authors randomly picked a transcript (array spot), which could only be picked once. Authors combined all the expression values of this transcript and randomly distributed them over the replicates and used them in the linear model. In this way authors obtained a threshold for each of the toxicants. Authors used a -log10 p-value 2 as common threshold for the analysis, which resembles to the following FDR per toxicant: 0.0155 for CPF at 24 centigrade, 0.0148 for DZN at 24 centigrade, 0.0168 for CPF+DZN at 24 centigrade, 0.0142 for CPF at 16 centigrade, 0.0151 for DZN at 16 centigrade, and 0.0148 for CPF+DZN, at 16 centigrade. WBPaper00040210:Chlorpyrifos_24C_regulated
  Genes with differential expression under 0.5mg/l Diazinon (DZN) treatment at 24 centigrade. To identify the differentially expressed genes in each treatment authors used linear models per toxicant and temperature (gene expression = Toxicant (effect) + error). The lm function in R stats package was used to implement the linear models analysis with recommended default options. For threshold determination authors used a permutation approach. For each of the 23,232 permutations used authors randomly picked a transcript (array spot), which could only be picked once. Authors combined all the expression values of this transcript and randomly distributed them over the replicates and used them in the linear model. In this way authors obtained a threshold for each of the toxicants. Authors used a -log10 p-value 2 as common threshold for the analysis, which resembles to the following FDR per toxicant: 0.0155 for CPF at 24 centigrade, 0.0148 for DZN at 24 centigrade, 0.0168 for CPF+DZN at 24 centigrade, 0.0142 for CPF at 16 centigrade, 0.0151 for DZN at 16 centigrade, and 0.0148 for CPF+DZN, at 16 centigrade. WBPaper00040210:Diazinon_24C_regulated
  Coexpression clique No. 282, srj-21-srh-32, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-21-srh-32
  Class B gene expression showed up regulation in lin-14(lf) in L1, no change in lin-4(lf) in L2. Raw data from each experiment were downloaded from the Stanford Microarray Database into Excel files and processed as follows: (i) sort by Spot Flag and discard any rows where the Spot Flag value was nonzero, indicating a bad PCR; (ii) sort by Failed and discard any rows where the Failed value was nonzero, indicating abnormal hybridization; (iii) import into a common file for each type of experiment (i.e., lin-14 or lin-4) the columns from each raw experimental file [RAT2(R/G), which shows a log base 2 transformed ratio of normalized red/green signal for each spot; name of spot (Wormbase designation); chromosome location and description (www.wormbase.org)]; (iv) calculate an average RAT2(R/G) based on the 2 or 3 values (avg; any rows which had only one good experimental value were discarded); (v) calculate a standard deviation (stdev) for the average value; (vi) calculate a t value for each spot by using the formula t = avg*[sqrt(n - 1)]/stdev, where n is the number of experiments for which good data exist, sqrt is square root, and stdev is standard deviation; (vii) sort by absolute t value and discard any rows with a t value below 4.303 (below 95% confidence interval for three experiments) or below 12.706 (below 95% confidence interval for two experiments); (viii) sort by absolute average value and discard any rows with average values below 1.0 (less than twofold change compared to control). WBPaper00026952:class_B

5 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : No comments. Strain: BC14652 [srb-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCTGTTAGCTTTCATACCGGAAG] 3' and primer B 5' [TGATATCTTTTGTTCTCCGTGCT] 3'. Expr5981 Adult Expression: intestine; rectal gland cells; Larval Expression: intestine; rectal gland cells;  
    Expr2034415 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1150492 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1022934 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2016188 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005073 7171857 7173590 1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
1734

1 Sequence Ontology Term