WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00001710 Gene Name  grl-1
Sequence Name  ? C24G6.7 Brief Description  grl-1 encodes a hedgehog-like protein, with an N-terminal signalsequence, a central proline-rich region, and a C-terminal Ground-like(Grl) domain; GRL-1 is expressed in intestine, neurons, and larvalarcade cells; the Grl domain is predicted to form a cysteine-crosslinkedprotein involved in intercellular signalling, and it has subtlesimilarity to the N-terminal Hedge domain of HEDGEHOG proteins.
Organism  Caenorhabditis elegans Automated Description  Expressed in lumbar ganglion and tail.
Biotype  SO:0001217 Genetic Position  V :-1.69348 ±0.010626
Length (nt)  ? 3131
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00001710

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C24G6.7.1 C24G6.7.1 1204   V: 5530725-5533855
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C24G6.7 C24G6.7 1047   V: 5530872-5531051

3 RNAi Result

WormBase ID
WBRNAi00041104
WBRNAi00011121
WBRNAi00029154

54 Allele

Public Name
gk963301
WBVar02060128
gk963591
gk963553
gk964259
gk964351
gk963850
gk964183
gk964184
WBVar01588269
WBVar01588267
WBVar01588268
WBVar01588266
WBVar01973509
WBVar01973508
WBVar01651602
h17295
gk742997
gk818809
gk719836
gk835892
gk479542
gk316447
gk884024
gk471861
gk410058
gk530314
gk452395
gk313728
gk601497

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00001710 5530725 5533855 -1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

166 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
  Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C. DESeq2, fold change > 2, p-value < 0.05. WBPaper00061753:csr-1(tor159)_upregulated_25C
Bacteria: E.faecalis strain OG1RF Transcripts that showed significantly increased expression after infection by E. faecalis OG1RF. Ballgown was used to calculate differential expression of genes using FPKM data and to generate tables with fold change and P values. Genes were shortlisted with a cutoff of 2-fold change and P values of less than 0.05. WBPaper00059754:E.faecalis_OG1RF_upregulated
  Genes that were downregulated in lin-15B(n744). For each gene in each microarray hybridization experiment, the ratio of RNA levels from the two samples was transformed into a log2 value and the mean log2 ratio was calculated. The log2 ratios were normalized by print-tip Loess normalization (Dudoit and Yang, 2002). All genes with a false discovery rate of <= 5% (q <= 0.05) (Storey and Tibshirani, 2003) and a mean fold-change ratio of >= 1.5 were selected for further analysis. WBPaper00038168:lin-15B(n744)_downregulated
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
  Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_SM
  Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2. DESeq2, Fold change > 1.5. WBPaper00051404:alg-1(gk214)_upregulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts that showed significantly increased expression in animal with pgph-2 overepxreesion [pgph-2p-pgph-2; myo-2p-mcherry] in glucose excess condition. Genes with anadjusted P-value <= 0.05 found by DESeq2 were assigned as differentially expressed. WBPaper00065926:pgph-2(overepxreesion)_upregulated_glucose
  Transcripts that showed significantly increased expression in xrep-4(lax137). DESeq2. Genes were selected if their p value < 0.01. WBPaper00066062:xrep-4(lax137)_upregulated
  Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult. The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak. WBPaper00044736:oscillating_dev_expression
  Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2. DESeq 2, fold change > 2, FDR < 0.05. WBPaper00065581:hpk-1(pk1393)_upregulated
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated
  Transcripts that showed significantly increased expression in wdr-23(mac32) embryos from parents fed with E. coliHB101, comparing to N2 embryos parents fed with E. coli HB101. DESeq2, Fold Change > 2 or < 0.5. WBPaper00059566:wdr-23(mac32)_upregulated
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. DESeq2, FDR <0.05, fold change > 2. WBPaper00059664:srbc-48(ac23)_upregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. Student's t-test, fold change > 2, p-value < 0.05. WBPaper00055386:daf-2(e1370)_upregulated
  Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals. DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction. WBPaper00060014:set-2(tm1630)_downregulated
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
  Transcripts that showed significantly increased expression in pgl-1(ct131) animals (isolated from SS0002[pgl-1(ct131)him-3(e1147)], comparing to in control animals SS1174, at 1-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_pgl-1(ct131)_vs_control_day1-adult
Bacteria infection: Serratia marcescens Genes with increased expression after 24 hours of infection by S.marcescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:S.marcescens_24hr_upregulated_TilingArray

7 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4440 Expressed in socket cells of IL or OLQ. Expressed in neurons of the lumbar ganglion, but the specific neurons were not identified.  
Strain: BC15287 [grl-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATGGCAACGATGAATAAA] 3' and primer B 5' [CTTTCATTGCGTCATTCTTTT] 3'. Expr5330 Adult Expression: intestine; Nervous System; head neurons; Larval Expression: arcade cells; intestine; Nervous System; head neurons; unidentified cells in tail ;  
    Expr1031023 Tiling arrays expression graphs  
    Expr2030490 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1028295 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr2012254 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1145139 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00001710 5530725 5533855 -1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
3131

1 Sequence Ontology Term