WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00017152 Gene Name  EGAP798.1
Sequence Name  ? EGAP798.1 Organism  Caenorhabditis elegans
Automated Description  Is affected by several genes including mut-16; hrde-1; and spe-44 based on microarray and RNA-seq studies. Is affected by Progesterone based on microarray studies. Biotype  SO:0000336
Genetic Position  Length (nt)  ? 2770
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00017152

Genomics

0 Transcripts

 

Other

0 CDSs

0 RNAi Result

6 Allele

Public Name
gk963301
gk964351
gk962860
gk964052
gk963442
gk963441

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00017152 8876035 8878804 1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_8878805..8879663   859 V: 8878805-8879663 Caenorhabditis elegans

25 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
  Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:sre-33-ZK1025.1_8337
  Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). CuffDiff2 WBPaper00051265:F4_hrde-1(tm1200)_upregulated
  Transcripts that showed significantly increased expression in mut-16(pk710), comparing to in N2 animals. DESeq2 v. 1.22.2, adjusted p-value <= 0.05. WBPaper00059605:mut-16(pk710)_upregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. Student's t-test, fold change > 2, p-value < 0.05. WBPaper00055386:daf-2(e1370)_upregulated
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
Temprature shift to 28C for 48 hours. Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 48 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_48h_upregulated
  Transcripts that showed significantly increased expression in smn-1(ok355) heterozygots using balancer hT2 comparing to in N2. DESeq v1.14.0, log2FC > 1, q <= 0.05. WBPaper00056809:smn-1(ok355)_upregulated
Bacteria infection: Photorhabdus luminescens Genes with increased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:P.lumniescens_24hr_upregulated_TilingArray
  Down-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. WBPaper00045774:clk-1_downregulated
  Transcripts that interact with 3xFLAG-DLC-1 as identified by immunoprecipitation followed by RNA sequencing. DESeq2, fold change > 2,, p-value < 0.01 WBPaper00055334:DLC-1_interacting
Bacteria infection: Enterococcus faecalis OG1RF. 16 hours of exposure after L4 larva stage at 25C. Transcripts that showed significantly increased expression in N2 animals fed by E. faecalis strain OG1RF for 16 hours after L4 larva stage at 25C. DESeq2, fold change > 2. WBPaper00061081:E.faecalis_upregulated_N2
  Transcripts that showed significantly increased expression in mex-3(eu149) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. RPKM fold change > 2. WBPaper00058598:mex-3(eu149)_upregulated
  Targets of endo-siRNA that showed significantly decreased expression in BFF40[meg-3(tm4259);meg-4(ax2026);mex-5::gfp::h2b::tbb-2] comparing to in SX1263[Pmex-5::gfp::h2b::tbb-2 (mjIs134 II)] dissected gonad isolated from 1-day old adult hermaphrodites. DESeq2, fold change > 2, FDR < 0.01 WBPaper00057140:meg-3(tm4259)_meg-4(ax2026)_downregulated
  Targets of endo-siRNA that showed significantly decreased expression in BFF39[pptr-1(tm3103);Pmex-5::gfp::h2b::tbb-2 (mjIs134 II)] comparing to in SX1263[Pmex-5::gfp::h2b::tbb-2 (mjIs134 II)] dissected gonad isolated from 1-day old adult hermaphrodites. DESeq2, fold change > 2, FDR < 0.01 WBPaper00057140:pptr-1(tm3103)_downregulated
  Targets of endo-siRNA that showed significantly decreased expression in the whole animal of JH3225[meg-3(tm4259) meg-4(ax2026)] comparing to in N2. DESeq2 1.22.2, fold change > 2, FDR < 0.05 WBPaper00057161:meg-3(tm4259)_meg-4(ax2026)_downregulated_endo-siRNA_targets
moderate static magnetic field Transcripts that showed significantly increased expression after exposure to moderate static magnetic field. N.A. WBPaper00064509:static-magnetic-field_upregulated
  Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for two generations (early generation). CuffDiff2 WBPaper00051265:F1_hrde-1(tm1200)_upregulated
  male sex-enriched Comparisons were made between genotypes by subtracting the mean log value of one ratio from another, and the significance of the difference was evaluated using Student t-test for two populations. For the fem-3(gf) versus fem-1(lf) direct comparison, authors performed the same analysis, except they used a Students t-test for one population. Author chose a combination of a twofold difference with a t value exceeding 99% confidence (P < 0.01), because these criteria allowed the inclusion of essentially all genes that had previously been identified as germline-enriched in a wt/glp-4 hermaphrodite comparison. Additionally, requiring a twofold difference reduced false positives, as the number of genes with two-fold difference and a P<0.01 only included ~100 genes more than with P < 0.001, and almost all genes showed germline expression by in situ hybridization. [cgc6390]:male_sex-enriched
  Genes up or down regulated by 10e-07M of progesterone. The normalized values used were G/R ratio > 2.6 for up-regulation and G/R ratio < 0.38 for down-regulation, which corresponds to 1.39 and -1.39 log(base2) G/R ratio, respectively. The normalized values used were: G/R ratio > 2.6 for up-regulation and G/R ratio < 0.38 for down-regulation, which corresponds to 1.39 and -1.39 log(base2) G/R ratio, respectively. WBPaper00005124:progesterone_10-7M_regulated
  Genes with significantly increased expression in spe-44(ok1400) comparing to N2. Microarray data were analyzed by Microarray Suite 5.0 (Affymetrix) and Genomics Suite (Partek) software, using a p-value threshold of 0.05 for differential expression. WBPaper00041071:spe-44_upregulated
  Transcripts that showed differential expression in hrde-1(tm1200) as well as in emb-4(qm31), comparing to in N2. DESeq2 v3.2.2 WBPaper00052885:hrde-1(tm1200)-emb-4(qm31)_regulated

5 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. Strain: BC15659 [EGAP798.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCATCGCTATCTTTCACCC] 3' and primer B 5' [TCGTCTGGATCCCCGATA] 3'. Expr5651 Adult Expression: intestine; rectal gland cells; Nervous System; head neurons; Larval Expression: intestine; rectal gland cells; Nervous System; head neurons;  
    Expr1162334 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
Original chronogram file: chronogram.1870.xml [EGAP798.1:gfp] transcriptional fusion. Chronogram829    
    Expr1013434 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1147698 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00017152 8876035 8878804 1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
2770

1 Sequence Ontology Term