WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00001701 Gene Name  grd-12
Sequence Name  ? F02D8.2 Brief Description  grd-12 encodes a hedgehog-like protein, with an N-terminal signalsequence, a central low-complexity proline-rich domain, and a C-terminalGround domain; GRD-12 is expressed in intestine, rectal epithelium,undefined head and tail cells, vulva, and hypodermis; the Ground domainis predicted to form a cysteine-crosslinked protein involved inintercellular signalling, and it has subtle similarity to the N-terminalHedge domain of HEDGEHOG proteins; GRD-12 is required for normal growthto full size, locomotion, and vulval morphogenesis; all of theserequirements may reflect common defects in cholesterol-dependenthedgehog-like signalling or in vesicle trafficking.
Organism  Caenorhabditis elegans Automated Description  Expressed in head; tail; and vulC.
Biotype  SO:0001217 Genetic Position  V :7.06093 ±0.016463
Length (nt)  ? 1746
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00001701

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:F02D8.2.1 F02D8.2.1 1127   V: 14978505-14980250
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F02D8.2 F02D8.2 858   V: 14978507-14978587

5 RNAi Result

WormBase ID
WBRNAi00043810
WBRNAi00077024
WBRNAi00077001
WBRNAi00012777
WBRNAi00030572

29 Allele

Public Name
gk963271
gk963301
gk964458
gk964459
gk963796
gk963805
WBVar02121479
WBVar02121480
WBVar01975585
ok2677
gk580219
gk366134
gk620262
gk498302
gk532962
gk445529
gk514681
gk802022
gk915907
WBVar00017930
WBVar00017935
WBVar01828391
gk597556
WBVar01775620
WBVar01463197
gk254822
gk254821
gk254820
tm11289

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00001701 14978505 14980250 1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

142 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
  Single-cell RNA-Seq cell group 84_0 expressed in neuron. scVI 0.6.0 WBPaper00065841:84_0
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
  Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. WBPaper00040858:eQTL_regulated_reproductive
Bacteria infection: Bacillus thuringiensis Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304. N.A. WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
  Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. Fold change > 2. WBPaper00064306:Agaro-oligosaccharides_upregulated
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Transcripts that showed significantly decreased expression in npr-8(ok1439) animals with 24 hour exposure to P. aeruginosa PA14, comparing to N2 animals with 24 hour exposure to P. aeruginosa PA14. DESeq2, fold change > 1.5, FDR < 0.05. WBPaper00058948:npr-8(ok1439)_downregulated_PA14
  Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult. The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak. WBPaper00044736:oscillating_dev_expression
  Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:hda-1(ne4752)_upregulated
  Transcripts that showed significantly increased expression in mbl-1(syb4345), referred to as mbl-1long(ex7+), comparing to in N2 at L4 larva stage. DESeq2, Fold change > 2 and FDR < 0.05 WBPaper00066410:mbl-1(syb4345)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:germline-precursors_blastula-embryo_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L3-L4-larva_expressed
  Transcripts that showed significantly increased expression in wdr-23(mac32) embryos from parents fed with E. coliHB101, comparing to N2 embryos parents fed with E. coli HB101. DESeq2, Fold Change > 2 or < 0.5. WBPaper00059566:wdr-23(mac32)_upregulated
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa. DESeq2, FDR <0.05, fold change > 2. WBPaper00059664:srbc-48(ac23)_upregulated
  Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals. DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction. WBPaper00060014:set-2(tm1630)_downregulated
Bacteria: B.thuringiensis Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. Cuffdiff WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
  Genes regulated by DAF-12, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12. Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons. WBPaper00050801:DAF-12_dauer_regulome
  Genes regulated by DAF-16, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12. Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons. WBPaper00050801:DAF-16_dauer_regulome
  Genes regulated by DPY-21, according to whole transcriptome profiling to compare genome-wide regulatory influences of DPY-21 and SET-4 to those of the key transcription factors controlling dauer arrest in eak-7;akt-1 animals, DAF-16 and DAF-12. Authors identified genes differentially expressed between wild-type and eak-7;akt-1 double mutant animals [fold change >= 1.5 and false discovery rate (FDR) < 0.05]. Authors then compared the transcriptomes of eak-7;akt-1 double mutants to those of eak-7;akt-1 animals harboring mutations in dpy-21, set-4, daf-16, or daf-12, and identified genes that are differentially expressed in the opposite direction as in wild-type relative to eak-7;akt-1. Annotated gene expression data output from CuffDiff v2.2.1 was read into R version 3.2.1 for six comparisons: eak-7;akt-1 compared to (1) wild-type, (2) daf-16(mu86);eak-7;akt-1, (3) daf-12;eak-7;akt-1, (4) set-4(n4600);eak-7;akt-1, (5) set-4(dp268);eak-7;akt-1, and (6) dpy-21;eak-7;akt-1. Authors filtered genes by the following criteria: (1) status = OK for wild-type vs. eak-7;akt-1, (2) fold change (FC) >= 1.5 or FC <= 1/1.5 for wild-type vs. eak-7;akt-1 and (3) FDR < 0.05 for at least two separate comparisons. WBPaper00050801:DPY-21_dauer_regulome
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L1-larva_expressed
  Transcripts that showed significantly decreased expression in rrf-3(pk1426) comparing to in N2 at L3 larva stage. DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. WBPaper00056169:rrf-3(pk1426)_downregulated_L3
  Transcripts that showed significantly decreased expression after animals grew in 500 uM glycine from hatch till 1-day post L4 adult, comparing to untreated animals. Differential expression was assessed using a nempirical Bayes moderated t-test within limmas linear model framework including the precision weights estimated by voom.Resulting p-values were corrected for multiple testing using the Benjamini-Hochberg false discovery rate. Curator applied threshold: fold change > 2, adjusted p-value < 0.01. WBPaper00056330:glycine_downregulated

9 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4436 Expressed in the rectal epithelial cells from L1 and maintained through adulthood. Expressed in VulC.  
    Expr1031016 Tiling arrays expression graphs  
Strain: BC12962 [grd-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCAAAACAATGTGTATCGACG] 3' and primer B 5' [TCGGCCTGTGTAAGATTTCTG] 3'. Expr5661 Adult Expression: intestine; rectal epithelium; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; rectal epithelium; hypodermis; unidentified cells in head; unidentified cells in tail ;  
Strain: BC14022 [grd-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCAAAACAATGTGTATCGACG] 3' and primer B 5' [TCGGCCTGTGTAAGATTTCTG] 3'. Expr5662 Adult Expression: intestine; rectal epithelium; Reproductive System; vulva other; hypodermis; unidentified cells in tail ; Larval Expression: intestine; rectal epithelium; Reproductive System; developing vulva; hypodermis; unidentified cells in tail ;  
    Expr2012226 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1147783 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1018977 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.645.xml [F02D8.2:gfp] transcriptional fusion. Chronogram1727    
    Expr2030462 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00001701 14978505 14980250 1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
1746

1 Sequence Ontology Term