WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005650 Gene Name  srp-9
Sequence Name  ? F09C6.5 Organism  Caenorhabditis elegans
Automated Description  Is affected by several genes including cyc-1; isp-1; and npr-1 based on microarray and RNA-seq studies. Is affected by seven chemicals including aldicarb; methylmercuric chloride; and multi-walled carbon nanotube based on microarray and RNA-seq studies. Biotype  SO:0000336
Genetic Position  V :11.2658 ±0.008799 Length (nt)  ? 1324
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005650

Genomics

0 Transcripts

 

Other

0 CDSs

0 RNAi Result

70 Allele

Public Name
gk963271
gk963489
gk963304
WBVar02123303
WBVar02124908
gk964050
WBVar02123708
gk963587
gk963588
WBVar02124497
WBVar02124626
WBVar02124059
WBVar02121796
WBVar02124430
WBVar02122255
gk962630
WBVar02122686
WBVar02124833
WBVar02122326
WBVar01652723
WBVar01652722
WBVar01652724
WBVar01635749
WBVar01635750
WBVar01635751
tm7709
h5595
gk259066
gk259065
gk259068

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005650 16894230 16895553 -1

2 Data Sets

Name URL
WormBaseAcedbConverter  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_16894108..16894229   122 V: 16894108-16894229 Caenorhabditis elegans

38 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly decreased expression in dissected female germline comparing to in dissected male germline. Log2 Fold change > 2 or <-1, p-value < 0.05. WBPaper00053599:female_vs_male_downregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. WBPaper00053810:daf-2(e1370)_upregulated
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. Student's t-test, fold change > 2, p-value < 0.05. WBPaper00055386:daf-2(e1370)_upregulated
  Transcripts that showed significantly decreased expression after animals grew in 500 uM glycine from hatch till 1-day post L4 adult, comparing to untreated animals. Differential expression was assessed using a nempirical Bayes moderated t-test within limmas linear model framework including the precision weights estimated by voom.Resulting p-values were corrected for multiple testing using the Benjamini-Hochberg false discovery rate. Curator applied threshold: fold change > 2, adjusted p-value < 0.01. WBPaper00056330:glycine_downregulated
  Transcripts that showed significantly decreased expression in whole animal day 1 N2 adults comparing to in whole animal day 8 N2 adults. DESeq2, FDR < 0.05, fold change > 2. WBPaper00066978:Day1Adult_vs_Day8Adult_downregulated_neuron
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_14
  Significantly downregulated genes from cyc-1(RNAi) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips. SAM algorithm with an FDR < 0.1. WBPaper00033065:cyc-1(RNAi)_downregulated
  Transcripts that showed significantly increased expression in pals-17(syb3980) comparing to in N2 animals at young adult stage. Differential expression analyses were performed using limma-voom in Galaxy, adj p <= 0.05, logFC > 2 WBPaper00065984:pals-17(syb3980)_upregulated
  Genes that showed increased expression after exposure to 7.5uM CH3HgCl for 24 hours. Rosetta Resolver was used to identify differentially expressed genes using an error-weighted, 1-way ANOVA with a Bonferroni correction. A 2-fold change in expression, relative to untreated controls, and a p-value < 0.01 was required for a gene to qualify as significantly, differentially expressed. WBPaper00044316:CH3HgCl_7.5uM_upregulated
  Transcripts that did not alter expression in smg-1(r910) and smg-1(r910) smg-2(r915) mutants comparing to in N2, but their mRNAs co-purify with SMG-2. edgeR WBPaper00053308:SMG-2_associated_NMD(-)_unaltered_ClassII
  Genes that showed significantly altered expression between N2 and npr-1(ur89) strains exposed to either the nematocidal B. thuringiensis B-18247, the pathogenic P. aeruginosa PA14, or the control E. coli OP50. Estimation of transcript abundance and significantly differentially expressed genes were identified by Cuffdiff using the quartile normalization method. Transcripts with a significant change between different conditions (adjusted p-value < 0.01 by the false discovery rate, FDR) were treated as signature for each comparison. WBPaper00049498:npr-1(ur89)_regulated_1
Bacteria: B.subtilis Transcripts that showed significantly increased expression when animals were fed by probiotic bacteria strain B.subtilis PXN21 comparing to animals fed with OP50 from L1 till day 1 adult. edgeR 3.16.5, FDR < 0.05, fold change > 2. WBPaper00059117:B.subtilis_upregulated
  Transcripts that showed significantly increased expression in diploid N2 animals after exposure to 5 uM doxorubicin for 72 hours at 15C from L1 to L4 larve stage. DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. WBPaper00066110:Doxorubicin_upregulated_diploid
  Transcripts that showed significantly increased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage. DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. WBPaper00066110:tetraploid_vs_diploid_upregulated
Bacteria infection: Enterococcus faecalis OG1RF. 16 hours of exposure after L4 larva stage at 25C. Transcripts that showed significantly increased expression in N2 animals fed by E. faecalis strain OG1RF for 16 hours after L4 larva stage at 25C. DESeq2, fold change > 2. WBPaper00061081:E.faecalis_upregulated_N2
  Transcripts that showed significantly increased expression in hlh-26(ok1453) animals exposed to E. faecium for 8 hours, comparing to N2 animals exposed to E. faecium for 8 hours. Fold change > 2. WBPaper00062585:hlh-26(ok1453)_upregulated_E.faecium
  Transcripts that showed significantly increased expression in mip-1(how5) comparing to in control animals. DESeq2, fold change > 2. WBPaper00066038:mip-1(how5)_upregulated
  Transcripts that showed significantly increased expression in animals with pan-neuronal expression of human amyloid beta (snb-1p-Amyloid-beta(1-42) + mtl-2p-GFP), comparing to in N2 animals. edgeR p-value < 0.01 and fold change > 4. WBPaper00061613:human-amyloid-beta_upregulated
Bacteria diet: Escherichia coli HB101. Fed for 30 generations. Transcripts that showed significantly increased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50. DESeq2 fold change > 2, p-value < 0.01. WBPaper00061007:HB101_upregulated
  Transcripts that showed significantly increased expression in eat-2(ad465) comparing to in N2. Student's t-test, fold change > 2, p-value < 0.05. WBPaper00055386:eat-2(ad465)_upregulated
  Transcripts that showed significantly decreased expression in isp-1(qm150) comparing to in N2. Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. WBPaper00053810:isp-1(qm150)_downregulated
  Transcripts that showed significantly increased expression in CB4856 animals growing in 15mg per mL doxycycline from L1 to L4 larva stage. edgeR (version 3.24.3), fold change > 4, FDR < 0.01. WBPaper00062456:doxycycline_upregulated_CB4856_transcript
  Transcripts that showed significantly increased expression in N2 animals growing in 15mg per mL doxycycline from L1 to L4 larva stage. edgeR (version 3.24.3), fold change > 4, FDR < 0.01. WBPaper00062456:doxycycline_upregulated_N2_transcript
  Genes that were enriched in spermatogenic fem-3(q96gf) gonads comparing to in oogenic fog-2(q71), according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Spermatogenic
  Transcripts with significantly decreased expression after treatment with 0.1mM paraquat vs. control Comparisons of each genotype were compared to the wild-type using the Empirical Base (Wright & Simon) algorithm and fold changes were represented on a log2 scale. A threshold of p < 0.05 and a fold change of 1.3 (log2) was set to determine differentially expressed targets. WBPaper00045263:0.1mM-paraquat_downregulated
  Transcripts that showed significantly increased expression in hpl-2(tm1489) comparing to in N2 animals. DESeq2, adjusted p-value < 0.05, log2 fold change > 2 or < -2. WBPaper00054493:hpl-2(tm1489)_upregulated
  Expression Pattern Group E, enriched for genes involved in dephosphorylation. The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05. WBPaper00036286:Pattern_E
  spermatogenesis-enriched Comparisons were made between genotypes by subtracting the mean log value of one ratio from another, and the significance of the difference was evaluated using Student t-test for two populations. For the fem-3(gf) versus fem-1(lf) direct comparison, authors performed the same analysis, except they used a Students t-test for one population. Author chose a combination of a twofold difference with a t value exceeding 99% confidence (P < 0.01), because these criteria allowed the inclusion of essentially all genes that had previously been identified as germline-enriched in a wt/glp-4 hermaphrodite comparison. Additionally, requiring a twofold difference reduced false positives, as the number of genes with two-fold difference and a P<0.01 only included ~100 genes more than with P < 0.001, and almost all genes showed germline expression by in situ hybridization. [cgc6390]:spermatogenesis-enriched

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC15187 [srp-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATAGGTTCTGATACACGTGGTG] 3' and primer B 5' [GCGATTCTGAAAATACATTGTTTG] 3'. Expr5695 Larval Expression: intestine;  

0 GO Annotation

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005650 16894230 16895553 -1

0 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

Length
1324

1 Sequence Ontology Term