WormMine: Strain WBStrain00022439

• WormBase ID: WBStrain00022439
• CGC Received: 2014-11-11
• Genotype: nos-2(ax2033) II.
• Laboratory: CGC
• Mutagen: CRISPR_Cas9
• Name: JH3180
• Outcrossed: x0
• Remark: Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23.
• Species: Caenorhabditis elegans

1 Alleles

Public Name
ax2033

1 Data Sets

• WormBaseAcedbConverter

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00003784	nos-2	ZK1127.1	Caenorhabditis elegans