1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00018788 | shc-1 | F54A5.3 | Caenorhabditis elegans |
| WormBase ID | WBStrain00028776 | CGC Received | 2002-05-06 |
| Genotype | F54A5.3a(ok198) I. | Laboratory | CGC |
| Made By | WBPerson436 | Mutagen | UV+TMP |
| Name | NH3119 | Outcrossed | x4 |
| Remark | No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00018788 | shc-1 | F54A5.3 | Caenorhabditis elegans |
