WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Hide

Oops!

http://intermine.wormbase.org/tools/wormmine/service/ is incorrect

Gene :

WormBase Gene ID  ? WBGene00018788 Gene Name  shc-1
Sequence Name  ? F54A5.3 Brief Description  shc-1 encodes four proteins by multiple splicing, three of which are rather small (52-81 residues); however, one isoform (F54A5.3A, 316 residues) is a ortholog of vertebrate Shc proteins (e.g., p52/p46SHC and p66SHC); like its orthologs, F54A5.3A has a PTB and an SH2 domain in N- to C-terminal order; shc-1 interacts with both the JNK and insulin signaling pathways to regulate stress response and adult life span; SHC-1::GFP is widely expressed during postembryonic development and localizes to both the cytoplasm and the nucleus.
Organism  Caenorhabditis elegans Automated Description  Enables insulin-like growth factor receptor binding activity; mitogen-activated protein kinase kinase binding activity; and mitogen-activated protein kinase kinase kinase binding activity. Involved in positive regulation of axon regeneration; response to endoplasmic reticulum stress; and response to metal ion. Located in cytoplasm and nucleus. Expressed in gonad; head; neurons; and tail. Human ortholog(s) of this gene implicated in steatotic liver disease. Is an ortholog of human SHC4 (SHC adaptor protein 4).
Biotype  SO:0001217 Genetic Position  I :-17.4191 ±0.002963
Length (nt)  ? 7473
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00018788

Genomics

9 Transcripts

Class WormMine ID Sequence Name Length (nt) Chromosome Location
MRNA Transcript:F54A5.3b.2 F54A5.3b.2 1750   I: 969088-973123
MRNA Transcript:F54A5.3a.1 F54A5.3a.1 1624   I: 969088-973133
MRNA Transcript:F54A5.3b.3 F54A5.3b.3 1407   I: 969088-972721
MRNA Transcript:F54A5.3b.1 F54A5.3b.1 5250   I: 969088-976560
NcPrimaryTranscript Transcript:F54A5.3c F54A5.3c 1097   I: 969680-973052
NcPrimaryTranscript Transcript:F54A5.3d F54A5.3d 1087   I: 969680-973052
NcPrimaryTranscript Transcript:F54A5.3e F54A5.3e 811   I: 969680-976550
NcPrimaryTranscript Transcript:F54A5.3f F54A5.3f 947   I: 969680-976550
NcPrimaryTranscript Transcript:F54A5.3g F54A5.3g 4585   I: 969680-976550
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F54A5.3a F54A5.3a 951   I: 969680-969838
CDS:F54A5.3b F54A5.3b 684   I: 969680-969838

10 RNAi Result

WormBase ID
WBRNAi00007492
WBRNAi00048215
WBRNAi00109620
WBRNAi00032731
WBRNAi00032732
WBRNAi00109232
WBRNAi00109329
WBRNAi00109523
WBRNAi00094878
WBRNAi00109426

156 Allele

Public Name
gk963902
gk963630
gk963701
otn12758
WBVar02066101
WBVar01545560
WBVar01545561
WBVar02028148
WBVar01930309
WBVar01930308
WBVar01930310
WBVar02073604
WBVar00148009
WBVar00148008
tm1729
WBVar02076980
WBVar00532947
WBVar00532948
WBVar01555119
WBVar01661508
WBVar01402286
WBVar01947243
WBVar01947244
tm10611
gk102101
gk102102
gk102103
gk102104
gk102097
gk102098

1 Chromosome

WormBase ID Organism Length (nt)
I Caenorhabditis elegans 15072434  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00018788 969088 976560 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

0 Downstream Intergenic Region

119 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. DESeq2, fold change > 2, p-value < 0.01. WBPaper00061203:sin-3(tm1276)_upregulated
  Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. DESeq2(v1.32.0), FDR < 0.05. WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
  Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. DESeq WBPaper00053302:stavudine_24h_regulated
  Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. DESeq2, fold change > 2, adjusted p-value < 0.01 WBPaper00058598:sin-3(tm1276)_downregulated
  Genes with increased RNA expression after 24 hours rotenone treatment EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed. WBPaper00044426:rotenone_24h_upregulated
  Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:Cisplatin_downregulated_WT
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:germline-precursors_blastula-embryo_expressed
  Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. WBPaper00062159:hda-2(ok1479)_upregulated
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage. DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2. WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L1-larva_expressed
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_L1-larva_expressed
  Transcripts of coding genes that showed significantly increased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_enriched_coding-RNA
  Genes expressed in N2. Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. WBPaper00025141:N2_Expressed_Genes
  Transcripts unqiuely expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_enriched
heat-shock hlh-1 Genes enriched in HLH-1 heat shock dataset. A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets. WBPaper00031003:hlh_1_enriched
  Transcripts that showed significantly increased expression in lin-22(ot269) comparing to in N2 at L3 larva. Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1). WBPaper00053295:lin-22(ot269)_upregulated
Bacteria infection: N.ausubeli Transcripts that showed significantly altered expression in C. elegans wild isolate strain JU1400 infected by N.ausubeli microsporidia spores for 72 hours at 21C starting from L1 larva stage. FDR < 0.01 WBPaper00065086:JU1400_N.ausubeli_regulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVA-neuron_L1-larva_expressed

15 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr2034039 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Strain: BC10623 [F54A5.3a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGGATAACCTCCCGGAAAT] 3' and primer B 5' [CGCCGCAAGTTGATTTTT] 3'. Expr6164 Adult Expression: intestine; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; Larval Expression: intestine; anal depressor muscle; body wall muscle; hypodermis;  
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10853 [F54A5.3A::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGGATAACCTCCCGGAAAT] 3' and primer B 5' [CGCCGCAAGTTGATTTTT] 3'. Expr6165 Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; intestine; Nervous System; nerve ring; head neurons; tail neurons;  
Strain: BC10733 [F54A5.3a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGGATAACCTCCCGGAAAT] 3' and primer B 5' [CGCCGCAAGTTGATTTTT] 3'. Expr6166 Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; phasmids; Larval Expression: pharynx; intestine; body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; phasmids;  
Strain: BC12999 [F54A5.3d::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAGGCTCAGGCTCATGCTT] 3' and primer B 5' [ACTCGAAATTCGTTACAACCG] 3'. Expr6167 Adult Expression: anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: anal depressor muscle; Reproductive System; developing vulva; body wall muscle; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;  
Picture: Figure 5.   Expr8347 Expressed ubiquitously in tissues such as the hypodermis, intestine, pharynx, neurons, and body muscles.  
Picture: Fig. 1 D to H.   Expr8394 Broad expression of shc-1::gfp was observed in many tissues. GFP staining was observed in head and tail neurons, hypodermis, pharynx, vulva muscles, and intestine throughout all stages of post-embryonic development and adulthood. In most cells, SHC-1::GFP localized to both the cytoplasm and the nucleus. A portion of the protein seems to be associated with the cytoplasmic membrane. Interestingly, in intestinal cells SHC-1::GFP strongly localized to the nucleus.
Original chronogram file: chronogram.1024.xml [F54A5.3:gfp] transcriptional fusion. Chronogram30    
    Expr1152021 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1038102 Tiling arrays expression graphs  
Original chronogram file: chronogram.1119.xml [F54A5.3:gfp] transcriptional fusion. Chronogram111    
Original chronogram file: chronogram.1697.xml [F54A5.3:gfp] transcriptional fusion. Chronogram668    
    Expr2015806 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1028343 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.741.xml [F54A5.3:gfp] transcriptional fusion. Chronogram1831    

17 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  enables
  enables
  enables

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00018788 969088 976560 -1

17 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  located_in
  located_in
  located_in
  located_in
  located_in
  located_in
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
7473

1 Sequence Ontology Term

Identifier Name Description
gene  

4 Strains

WormBase ID
WBStrain00028776
WBStrain00054667
WBStrain00001443
WBStrain00002891

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrI_976561..979124   2564 I: 976561-979124 Caenorhabditis elegans