1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004307 | rap-1 | C27B7.8 | Caenorhabditis elegans |
| WormBase ID | WBStrain00051648 | CGC Received | 2021-07-06 |
| Genotype | rap-1(re180) IV. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | DV3313 |
| Outcrossed | x3 | Remark | Gain-of-function allele (G12V). Low penetrance of 3 to 1 fate transformations (Muv) and duplication of the excretory duct cell. Genotyping primers (Tm=50C, followed by BamHI digestion): oNR122: TGTGTCATCTGGTCTGTACTTGG; oNR123: TCCCCTGCACGAATTGTACC. Reference: Rasmussen NR, Dickinson DJ, and Reiner DJ. Genetics Dec;210(4):1339-1354. doi: 10.1534/genetics.118.301601. PMID: 30257933. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004307 | rap-1 | C27B7.8 | Caenorhabditis elegans |
