WormMine: Gene WBGene00004307

• WormBase Gene ID: WBGene00004307
• Gene Name: rap-1
• Sequence Name: C27B7.8
• Brief Description: rap-1 encodes a member of the Ras superfamily of small GTPases; the activated protein interacts with W05B10.4 and T14G10.2 in yeast two-hybrid assays and rap-1 is expressed in some neurons in the head and tail, the rectal epithelial cells, body muscle, hypodermis, and in the somatic cells of the gonad.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable GDP binding activity; GTP binding activity; and GTPase activity. Involved in collagen and cuticulin-based cuticle development and epidermis development. Predicted to be located in plasma membrane. Expressed in several structures, including germ line; gonad; and neurons. Human ortholog(s) of this gene implicated in thrombocytopenia. Is an ortholog of human RAP1A (RAP1A, member of RAS oncogene family) and RAP1B (RAP1B, member of RAS oncogene family).
• Biotype: SO:0001217
• Genetic Position: IV :3.99974 ±2e-05
• Length (nt): 2641

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004307

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C27B7.8.1	C27B7.8.1	1318	IV: 8916250-8918890

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C27B7.8	C27B7.8	567	IV: 8916885-8916986

16 RNAi Result

• WBRNAi00107765
• WBRNAi00041321
• WBRNAi00099878
• WBRNAi00100364
• WBRNAi00011246
• WBRNAi00029261
• WBRNAi00100738
• WBRNAi00099676
• WBRNAi00099272
• WBRNAi00099474
• WBRNAi00093200
• WBRNAi00061738
• WBRNAi00099990
• WBRNAi00100177
• WBRNAi00100551
• WBRNAi00100925

45 Allele

• gk964278
• gk964500
• gk962765
• gk962666
• tm861
• h12151
• WBVar01730281
• WBVar01730282
• pk2082
• gk477228
• gk765381
• gk623009
• gk706046
• gk905532
• gk630667
• WBVar01855041
• WBVar01855040
• WBVar01990918
• WBVar01855042
• gk499508
• gk208041
• gk423695
• gk208042
• gk208039
• gk208040
• gk535175
• gk341665
• gk621443
• gk535176
• gk645337

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004307
• Start: 8916250
• End: 8918890
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_8916111..8916249
• Length (nt): 139
• Chromosome Location: IV: 8916111-8916249
• Organism: Caenorhabditis elegans

122 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Genes with increased RNA expression after 24 hours rotenone treatment	EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed.	WBPaper00044426:rotenone_24h_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:excretory-cell_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:germline-precursors_blastula-embryo_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_larva_enriched
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Proteins identified in extracellular vesicle.	N.A.	WBPaper00062669:extracellular-vesicle_protein

9 Expression Patterns

• Primary Identifier: Expr5350
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15705
• Reporter Gene: [rap-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGATCGTTTATCAACACTTCCTT] 3' and primer B 5' [ATCTGTTATGGTGTTGTTGATGCT] 3'.
• Pattern: Adult Expression: intestine; rectal gland cells; Reproductive System; spermatheca uterine valve; body wall muscle; Nervous System; head neurons; tail neurons; Larval Expression: intestine; rectal gland cells; body wall muscle; hypodermis; Nervous System; head neurons; tail neurons

• Primary Identifier: Expr12382
• Subcellular Localization: mNG::RAP-1 localized to the plasma membrane in a wide range of tissues including neurons, intestine and the germline.

• Primary Identifier: Expr1032132
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr13938
• Pattern: Tagged RAP- 1 expression was ubiquitous throughout the animal during development, and localized to the plasma membrane. Of particular importance to this study, RAP-1 expression was observed in the VPCs throughout the L3 stage, when specification occurs (1 cell stage, Pn.p), after EGF induction (2 cell stage, Pn.px), and throughout vulval morphogenesis. Tagged endogenous RAP-1 is also localized to cell-cell junctions between hypodermal seam cells. Intriguingly, increased expression of tagged endogenous RAP-1 was observed in the anchor cell. Additionally, increased expression of RAP-1 was observed in the distal tip cell (DTC) of the developing somatic gonad.

• Primary Identifier: Expr1026296
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2015255
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr13836
• Pattern: rap-1 and rap-3 are not expressed in motor neurons.

• Primary Identifier: Expr1145365
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2033489
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

19 GO Annotation

13 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004307
• Start: 8916250
• End: 8918890
• Strand: -1

19 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 2641

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00024306
• WBStrain00035168
• WBStrain00051648
• WBStrain00007655
• WBStrain00007656

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_8918891..8919541
• Length (nt): 651
• Chromosome Location: IV: 8918891-8919541
• Organism: Caenorhabditis elegans