2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001946 | his-72 | Y49E10.6 | Caenorhabditis elegans |
| WBGene00006843 | unc-119 | M142.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00051686 | CGC Received | 2021-12-21 |
| Genotype | muIs252 II; unc-119(ed3) his-72(utx21[his-72::wrmScarlet11::3xMyc]) III. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | GLW27 |
| Outcrossed | x0 | Remark | muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. C-terminal tag of HIS-72 via CRISPR/Cas9 knock-in of wrmScarlet11 into endogenous his-72 locus. Genetic background: strain CF4582. Insertion verified by PCR and fluorescence. Left flank: 5' CTCGCCAGACGCATTCGCGGAGAACGTGCT 3' (one silent mutation); Right flank: 5' TAAgctccatcaccaattctcgaagcactt 3'; sgRNA: GAGCTTAAGCACGTTCTCCG; Cas9/sgRNA plasmid: pGLOW87; wrmScarlet11^SEC^3xMyc plasmid: pGLOW88; SEC insertion allele strain: GLW26 |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001946 | his-72 | Y49E10.6 | Caenorhabditis elegans |
| WBGene00006843 | unc-119 | M142.1 | Caenorhabditis elegans |
