Genomics
2 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:Y49E10.6a.1 | Y49E10.6a.1 |
631
 |
III: 12367475-12368164 |
| Transcript:Y49E10.6b.1 | Y49E10.6b.1 |
456
|
III: 12367657-12369050 |
Other
2 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:Y49E10.6a | Y49E10.6a |
411
|
III: 12367688-12367816 |
| CDS:Y49E10.6b | Y49E10.6b |
456
|
III: 12367657-12367816 |
23 RNAi Result
123 Allele
| Public Name |
|---|
| gk963887 |
| gk964363 |
| gk964364 |
| gk188212 |
| gk188214 |
| gk188213 |
| WBVar02120486 |
| WBVar02123068 |
| WBVar00181428 |
| WBVar01542626 |
| WBVar02112547 |
| WBVar01509057 |
| WBVar01509058 |
| WBVar01509055 |
| WBVar01509056 |
| WBVar01509054 |
| WBVar01410136 |
| WBVar02089747 |
| WBVar02121017 |
| WBVar01963789 |
| WBVar01963788 |
| ok2316 |
| WBVar02123794 |
| WBVar01509059 |
| WBVar02118953 |
| WBVar02103335 |
| WBVar02108966 |
| WBVar01568169 |
| WBVar02081882 |
| WBVar02081881 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00001946 | 12367475 | 12369050 | -1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrIII_12367374..12367474 | 101 | III: 12367374-12367474 | Caenorhabditis elegans |
165 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin-Allantoin_upregulated | |
| Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). | DESeq2, fold change >= 2, FDR <= 0.01. | WBPaper00056826:SGP_biased | |
| Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Psora-Allantoin_upregulated | |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Maternal class (M): genes that are called present in at least one of the three PC6 replicates. | A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. | [cgc5767]:expression_class_M | |
| Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated | |
| 25C vs. 20C | Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C. | CuffDiff, fold change > 2. | WBPaper00065096:25C_vs_20C_upregulated |
| Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C. | CuffDiff, fold change > 2. | WBPaper00065096:Day10_vs_Day1_upregulated | |
| Genes with increased RNA expression after 24 hours rotenone treatment | EdgeR provides statistical routines for determining differential expression in digital gene expression data using a model based on the negative binomial distribution. The resulting p-values were adjusted using the Benjamini and Hochbergs approach for controlling the false discovery rate (FDR). Transcripts with an adjusted p-value smaller 0.05 were assigned as differentially expressed. | WBPaper00044426:rotenone_24h_upregulated | |
| Gamma irradiation 100 mGY per hour for 72 hours since L1 larva. | Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage. | DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3. | WBPaper00058958:100mGy-irradiation-72h_upregulated |
| Transcripts that showed significantly increased expression in clk-1(qm30) comparing to in N2. | Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1. | WBPaper00053810:clk-1(qm30)_upregulated | |
| Transcriptions that showed significantly increased expression in skn-1(RNAi) comparing to empty vector injection into rrf-3(pk1426);daf-2(e1368) animals. | Genes with an absolute fold changeof at least 2 and standard p-values below 0.05 were considered as differentially expressed. | WBPaper00062193:skn-1(RNAi)_upregulated | |
| Transcripts that showed significantly increased expression in hira-1(gk835598) comparing to in N2 animals at L4 larva stage. | Differential expression analysis was done with Rversion 2.15.3 using DESeq_1.10.1. Fold change > 2, p-value < 0.01. | WBPaper00059739:hira-1(gk835598)_upregulated_L4 | |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. | To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. | WBPaper00045521:Gender_Neutral | |
| Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector. | DESeq2. FDR < 0.05. | WBPaper00060459:bcat-1(RNAi)_downregulated | |
| Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C. | EdgeR, FDR < 0.05, fold change < 0.5. | WBPaper00055971:nhl-2(ok818)_25C_upregulated | |
| Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background. | DESeq2, FDR < 0.05 | WBPaper00060683:hlh-11(ko1)_downregulated | |
| Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. | N.A. | WBPaper00026929:sir-2.1_overexpression_regulated | |
| Transcripts of coding genes that showed significantly increased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_enriched_coding-RNA | |
| Genes expressed in N2. | Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0. | WBPaper00025141:N2_Expressed_Genes | |
| Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis. | A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. | [cgc5767]:expression_class_E | |
| Transcripts that showed significantly increased expression in emb-4(hc60) comparing to in N2. | DESeq2 | WBPaper00052884:emb-4(hc60)_upregulated | |
| Temprature shift to 28C for 48 hours. | Transcripts that showed significantly increased expression after animals were exposed to 28C temperature for 48 hours. | Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. | WBPaper00061341:28C_48h_upregulated |
| Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. | N.A. | WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C | |
| Embryonic A-class motor neuron enriched genes. | A two-class unpaired analysis of the data was performed to identify genes that differ by >= 1.5-fold from the reference at a FDR of <1% for the larval pan-neural, embryonic pan-neural, and larval A-class motor neuron datasets. | WBPaper00030839:Embryo_A_Class |
15 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| In embryos, HIS-72::GFP can be detected in nuclei at all stages. When fixed nuclei were viewed at high magnification, the most intense HIS-72::GFP and YFP::HIS-72 fluorescence appeared coincident with DAPI-stained DNA at all stages of the cell cycle. For example, mitotic chromosomes coalesce into a characteristic bar-shaped structure at metaphase that displayed high levels of fluorescence. These observations suggest that the tagged H3.3 proteins are incorporated into nucleosomes. To test this possibility in the his-72::gfp strain, authors used a high salt histone extraction method to separate nucleosomes (containing histone octamers) from nonnucleosomal proteins. Extracts from lysed embryonic nuclei were bound to hydroxyapatite and eluted at increasing salt concentrations. Nonnucleosomal proteins are predicted to elute in 0.35 M NaCl, and core histones elute in 2.5 M NaCl. Coomassie blue staining and Western blot analysis using an anti-histone H3 antibody confirmed that C. elegans histones are enriched in the 2.5 M NaCl eluate fractions. The majority of HIS-72::GFP, predicted to be about 42 kDa, stained positively with an anti-GFP antibody in the 2.5 M NaCl eluate fractions, indicating that HIS-72::GFP is incorporated into nucleosomes. The combined results suggest that H3.3 is present in chromatin throughout development. | Expr4221 | HIS-72::GFP displayed a similar expression pattern in almost all larval and adult nuclei , except that intestinal nuclei showed only low levels of expression. In crosses where sperm bearing the YFP::his-72 transgene fertilized wild-type oocytes, fluorescence from embryonic expression was detected at the approximately 26-cell stage (embryos with two E blastomeres). | Expressed in nuclei. | |
| Expr1031132 | Tiling arrays expression graphs | |||
| Expr7332 | Click the movie links below for interactive 4D movies of a fluorescence reporter. http://glowormnotes.blogspot.com/2009/11/his-72gfp-translational-fusion-expr7332.html | |||
| Also expressed in (comments from author) : Functional GFP::protein fusion.nuclear expression (his-72). Not in oocytes. Strain: BC12421 | [his-72::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAAATAACACGACAAGAAACG] 3' and primer B 5' [agcacgttctccgcggatgcgt] 3'. | Expr7019 | ||
| Expr10323 | Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/ | |||
| Expr15556 | We report similar localization of HIS-72::mTurquoise2 to previously generated HIS-72 fluorescent fusion strains in most nuclei of the animal. | |||
| Expr2012482 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr2030721 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr16324 | HIS-72 is visible in all somatic nuclei, consistent with Goudeau et al. 2021. | |||
| Expr15557 | HIS-72::mTurquoise2 shows chromatin labeling in the germline and all stages of the cell cycle in the early embryo. | |||
| Expr1170064 | Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191 | |||
| Expr1160470 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
| Expr14551 | The granular pattern of HIS-72::GFP expression in the nucleus suggested that HIS-72::GFP was deposited on the chromatin. | |||
| Expr15135 | His-72 is expressed ubiquitously in every cell, both in the soma and germ line at every stage of development in both males and hermaphrodites. Expression appears highest in embryos compared to other developmental stages based on GFP signal, consistent with RNA-seq data. However, the HIS-72 signal remaines detectable in all cells throughout development. | |||
| Expr15139 | HIS-72 and HIS-74 are visible on the condensed chromatin in the mitotic, transition, and pachytene zones. The signal of both proteins is depleted from one region of the chromatin in pachytene nuclei, as previously noted for HIS-72 (Ooi et al. 2006). Both proteins are depleted from the X chromosomes in these cells. During diakinesis, both HIS-72 and HIS-74 remain chromatin associated, but there are also high levels of the nonchromatin-associated protein in the nucleoplasm, obscuring the chromosomal GFP signal, as previously shown for HIS-72 (Ooi et al. 2006). The similarities of expression patterns and chroma- tin association suggest that the broad chromosomal incorporation in germ cells is similar for both proteins. | HIS-72 and HIS-74 are visible on the condensed chromatin in the mitotic, transition, and pachytene zones. The signal of both proteins is depleted from one region of the chromatin in pachytene nuclei, as previously noted for HIS-72 (Ooi et al. 2006). Both proteins are depleted from the X chromosomes in these cells. During diakinesis, both HIS-72 and HIS-74 remain chromatin associated, but there are also high levels of the nonchromatin-associated protein in the nucleoplasm, obscuring the chromosomal GFP signal, as previously shown for HIS-72 (Ooi et al. 2006). The similarities of expression patterns and chroma- tin association suggest that the broad chromosomal incorporation in germ cells is similar for both proteins. |
13 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| enables | |
| located_in | |
| enables | |
| enables | |
| enables | |
| part_of | |
| part_of | |
| located_in | |
| part_of | |
| located_in | |
| located_in |
13 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
13 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| located_in | |
| located_in | |
| enables | |
| located_in | |
| enables | |
| enables | |
| enables | |
| part_of | |
| part_of | |
| located_in | |
| part_of | |
| located_in | |
| located_in |
6 Regulates Expr Cluster
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| Transcripts that showed significantly increased expression in H3.3 null mutant animals (FAS43 [his-69&his-70(uge44) III; his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X]) comparing to in N2 animals at embryo stage. | Differentially expressed genes were estimated using a General Linear Model approach, negative binomial distribution, and a quasi-likelihood F-test. Genes with a P-value < 0.05 and fold change > 1 were considered significant. | WBPaper00054191:H3.3(null)_embryo_upregulated | |
| Transcripts that showed significantly increased expression in H3.3 null mutant animals (FAS43 [his-69&his-70(uge44) III; his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X]) comparing to in N2 animals at L1 larva stage. | Differentially expressed genes were estimated using a General Linear Model approach, negative binomial distribution, and a quasi-likelihood F-test. Genes with a P-value < 0.05 and fold change > 1 were considered significant. | WBPaper00054191:H3.3(null)_L1_upregulated | |
| Transcripts that showed significantly decreased expression in H3.3 null mutant animals (FAS43 [his-69&his-70(uge44) III; his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X]) comparing to in N2 animals at L1 larva stage. | Differentially expressed genes were estimated using a General Linear Model approach, negative binomial distribution, and a quasi-likelihood F-test. Genes with a P-value < 0.05 and fold change > 1 were considered significant. | WBPaper00054191:H3.3(null)_L1_downregulated | |
| Transcripts that showed significantly increased expression in FAS58[his-72(uge40)] comparing to in N2. | edgR v3.10.5 | WBPaper00056855:his-72(uge40)_upregulated | |
| Transcripts that showed significantly decreased expression in FAS58[his-72(uge40)] comparing to in N2. | edgR v3.10.5 | WBPaper00056855:his-72(uge40)_downregulated | |
| Transcripts that showed significantly decreased expression in H3.3 null mutant animals (FAS43 [his-69&his-70(uge44) III; his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X]) comparing to in N2 animals at embryo stage. | Differentially expressed genes were estimated using a General Linear Model approach, negative binomial distribution, and a quasi-likelihood F-test. Genes with a P-value < 0.05 and fold change > 1 were considered significant. | WBPaper00054191:H3.3(null)_embryo_downregulated |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrIII_12369051..12370455 | 1405 | III: 12369051-12370455 | Caenorhabditis elegans |
