2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001651 | gon-2 | T01H8.5 | Caenorhabditis elegans |
| WBGene00008214 | gem-1 | C49F8.2 | Caenorhabditis elegans |
| WormBase ID | WBStrain00007130 | CGC Received | 2017-03-13 |
| Genotype | gon-2(q388) I; gem-1(bc364) X. | Laboratory | CGC |
| Made By | WBPerson352 | Mutagen | EMS |
| Name | EJ1171 | Outcrossed | x4 |
| Remark | NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001651 | gon-2 | T01H8.5 | Caenorhabditis elegans |
| WBGene00008214 | gem-1 | C49F8.2 | Caenorhabditis elegans |
