1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003553 | nas-37 | C17G1.6 | Caenorhabditis elegans |
| WormBase ID | WBStrain00006680 | CGC Received | 2004-11-30 |
| Genotype | nas-37(tm410) X. | Laboratory | CGC |
| Made By | WBPerson128 | Mutagen | UV+TMP |
| Name | EG3283 | Outcrossed | x1 |
| Remark | At each molt the cuticle fails to open sufficiently at the anterior end and the partially shed cuticle is dragged behind the animal. Deletion. Flanking sequences: ttcttgtccagtagggtctagtcgtggttg tgaacttgcctgtcgatgtcttctggctga. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003553 | nas-37 | C17G1.6 | Caenorhabditis elegans |
