WormMine: Gene WBGene00003553

• WormBase Gene ID: WBGene00003553
• Gene Name: nas-37
• Sequence Name: C17G1.6
• Brief Description: nas-37 encodes a Astacin-class metalloprotease required for full ecdysisthat is expressed in hypodermal cells 4 hours before each ecdysis; NAS-37protein has an N-terminal signal sequence followed by an Astacin proteasedomain and three protein-binding domains (EGF-like, CUB, andthrombospondin); NAS-37 accumulates in anterior cuticle, being shed withit after ecdysis; nas-37 mutants fail to complete anterior ecdysis at eachmolt; nas-37(ox196) mutations alter an evolutionarily invariant histidineresidue yet are phenotypically indistinguishable from null mutations,consistent with the hypothesis that NAS-37 encodes a functional protease;NAS-37 orthologs are found in other nematodes such as Brugia malayi.
• Organism: Caenorhabditis elegans
• Automated Description: Enables metalloendopeptidase activity. Involved in collagen and cuticulin-based cuticle development and ecdysis, collagen and cuticulin-based cuticle. Located in extracellular region. Expressed in cuticle; epithelial cell; intestine; and rectal gland cell.
• Biotype: SO:0001217
• Genetic Position: X :1.73123 ±0.000121
• Length (nt): 4220

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003553

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C17G1.6a.1	C17G1.6a.1	2539	X: 9944844-9949060
Transcript:C17G1.6b.1	C17G1.6b.1	2302	X: 9944844-9949063

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C17G1.6a	C17G1.6a	2298	X: 9945084-9945146
CDS:C17G1.6b	C17G1.6b	2058	X: 9945084-9945146

11 RNAi Result

• WBRNAi00001846
• WBRNAi00024584
• WBRNAi00008413
• WBRNAi00040833
• WBRNAi00077141
• WBRNAi00066770
• WBRNAi00061419
• WBRNAi00061420
• WBRNAi00117221
• WBRNAi00110790
• WBRNAi00088990

69 Allele

• gk964260
• gk962707
• WBVar02065808
• WBVar02065809
• gk964090
• WBVar02069054
• tm410
• gk951786
• gk951787
• WBVar02045206
• WBVar02116614
• gk290794
• gk290793
• gk290792
• WBVar01897855
• WBVar01897856
• gk290791
• WBVar01888149
• gk290790
• WBVar01888150
• gk290789
• ox190
• WBVar01888151
• ox197
• WBVar01888152
• ox196
• ox199
• WBVar01888147
• WBVar01888148
• gk290796

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003553
• Start: 9944844
• End: 9949063
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

181 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq.	DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison.	WBPaper00045934:wrn-1(gk99)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Expression Pattern Group C, enriched for genes involved in metabolic processes.	The significance (P 0.0001) of the relative age (time) was used to determine if a gene was differentially expressed between the three age (time) groups. The effect of this factor explaining gene expression differences was used to determine if the expression went up or down during the two age/time periods (t1 - t2 and t2 -t3). Authors used a permutation approach to determine the thresholds for the different mapping strategies. For each of the used models for eQTL mapping, authors used 23,000 permutations. For each permutation, authors randomly picked a spot; each spot could only be picked once. The gene expression and relative lifespan values were than randomly distributed over the RILs (and time points) and used for mapping. In this way, authors obtained a threshold for each of the explaining factors. For the single time points, authors used a FDR of 0.01 to adjust for multiple testing. The genome-wide threshold for this FDR is -log10 P = 3.8 for each of the three time points. For the combined models (t1 to t2 and t2 to t3), authors used a genome-wide threshold of -log10 P = 4, which resembles an FDR of 0.006, 0.001, and 0.006 for marker, age, and the interaction between marker and age, respectively. To determine the threshold for the single gene examples, authors used 1000 permutations as in the genome-wide threshold. The difference is that they use the gene under study in all of the permutations. The P-values for the gene specific thresholds were determined at FDR = 0.05.	WBPaper00036286:Pattern_C
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite npr-8(ok1439) animals grown at 20C, comparing to in N2 animals.	CuffDiff, fold change > 2.	WBPaper00065096:npr-8(ok1439)_upregulated_Day1_20C
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult.	The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak.	WBPaper00044736:oscillating_dev_expression
Growth temperature	Transcripts that are significantly downregulated at 15C compared to both 25C and 20C, with no statistical difference between 25C and 20C, in worms feeding B. subtilis PY79.	DESeq2 and EdgeR, adjusted p-value < 0.05.	WBPaper00053814:15C_downregulated_PY79
	Transcripts that showed significantly increased expression in mbl-1(syb4345), referred to as mbl-1long(ex7+), comparing to in N2 at L4 larva stage.	DESeq2, Fold change > 2 and FDR < 0.05	WBPaper00066410:mbl-1(syb4345)_upregulated
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_larva_enriched
	Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_larva_SelectivelyEnriched

11 Expression Patterns

• Primary Identifier: Expr5287
• Remark: Strain: BC13462
• Reporter Gene: [nas-37::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAATATTGTAGGAGGCAAGTCG] 3' and primer B 5' [TGCAAAATAGAACATCAAGAATCG] 3'.
• Pattern: Adult Expression: rectal epithelium; Reproductive System; vulva other; seam cells; Larval Expression: rectal epithelium; hypodermis; seam cells

• Primary Identifier: Expr3124
• Pattern: Bright fluorescence was observed in the Hyp5 hypodermal cell at the anterior end of the larvae as well as at other attachment points of the cuticle at the anterior end of larvae, in the arcade cells in the mouth, the anterior pharynx and the amphid socket cells, and in the rectal epithelial cells at the posterior end of the larvae. Bright fluorescence was also observed in the hypodermal cells of each larval stage. Expression was not seen in the seam cells of L1 through L3 larvae; however, the seam cells of the L4 larvae strongly expressed nas-37::GFP. The L4 stage is when the seam cells terminally differentiate and fuse with the hypodermal syncytium. The expression in the hypodermis and seam cells disappeared in adult worms after a few hours. However, expression continued in the vulval epithelial cells and the rectal epithelial cells in the adult.

• Primary Identifier: Expr8931
• Remark: Picture: N.A.
• Pattern: Expressed in all intestinal cells(weak), major hypodermis including seam cells (weak), rectal epithelial cells, vulval epithelium and rectal epithelium.

• Primary Identifier: Expr3042
• Pattern: In the nas-37p::gfp-transformed animals, GFP was observed to be expressed in the hypoderma cells except the seam cells and in the rectal gland cells throughout the larval stages. When the -879 to +5 region instead of the -3679 to +5 region of nas-37 was used, a faint fluorescence of GFP was detected in the hypodermal seam cells but not in the other hypodermal cells. Therefore, it is thought that a DNA motif(s) essential for expression is located in the -3679 to +879 region of the nas-37 gene.

• Primary Identifier: Expr3126
• Pattern: The NAS-37::GFP fusion protein was found in the cuticle, with high concentration in the anterior of the worm overlying Hyp5. It was also concentrated in the alae, vulval cuticle and cuticle of the rectum. In addition, the protein was abundantly expressed in the excretory duct cell. The protein began to appear in the anterior cuticle 4 hours before each molt, consistent with the transcriptional GFP fusion results (see Expr3124 and Expr3125). Despite high levels of transcription of nas-37 in hypodermal cells, high levels of protein accumulation were not observed in these cells. GFP fluorescence was also observed in shed cuticles, demonstrating that the fusion protein is indeed secreted and deposited into the old cuticle.

• Primary Identifier: Expr3125
• Pattern: To test whether peak NAS-37 expression coincided with ecdysis in each larval stage, a PEST protein degradation signal was fused onto the C-terminus of the pWD90 GFP construct. This sequence increases protein turnover and should rapidly eliminate GFP fluorescence after expression has stopped. As expected, bright fluorescence was observed in the Hyp5 cell at the anterior tip of the animal and in the rectal epithelial cells at ecdysis. After the molt, nas-37 expression was very low in all cells, although expression continued in Hyp5 and the rectal epithelial cells. GFP expression driven by the nas-37 promoter (Pnas-37::GPF) began to rise about 6 hours before ecdysis, with peak nas-37 expression in hypodermal cells (and seam cells exclusively in the L4 stage) about 4 hours before each molt.

• Primary Identifier: Expr3691
• Pattern: Fluorescence was observed in epithelial cells that synthesize cuticle. Expressed in the hypodermis, including the major body syncytium, hyp7, and hypodermal cells in the head and tail. Also expressed in the lateral seam cells. Fluorescence from nas-37p::gfp-pest in seam cells was observed only before the L4 stage-to-adult molt, when the cells terminally differentiate and fuse. A pulse of fluorescence was observed in the hypodermis prior to molting. Expression of nas-37p::gfp-pest also cycled in phase with all four molts. Expression of the gfp fusion genes was never detected in the hypodermis of gravid adults that no longer molt.

• Primary Identifier: Expr1020217
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2013883
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1144876
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2032123
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

16 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003553
• Start: 9944844
• End: 9949063
• Strand: -1

16 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 4220

1 Sequence Ontology Term

• Name: gene

4 Strains

• WBStrain00037444
• WBStrain00006680
• WBStrain00006660
• WBStrain00002602

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrX_9949064..9950352
• Length (nt): 1289
• Chromosome Location: X: 9949064-9950352
• Organism: Caenorhabditis elegans