WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Anatomy Term :

Definition  Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. Name  nervous system
Primary Identifier  WBbt:0005735

5 Children

Definition Name Synonym Primary Identifier
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679
cells that support sensory neurons, similar to glial cells in vertebrates. A category which collectively refers to socket cells, sheath cells, and structural cells, or their processes. All of these cells extend long processes which serve a supporting role, rather like glia, to form a protective environment around sensory neuron endings. In addition, some of these cells extend broad thin processes from their somata which wrap around neuronal ganglia, again in a glia-like fashion accessory cell support cell WBbt:0005762
The pharyngeal nervous system is composed of 20 pharyngeal neurons which lie completely within the pharynx. pharyngeal nervous system   WBbt:0005440
A cluster of nerve cells and associated glial cells (nuclear location). ganglion   WBbt:0005189
Part of the nervous system that lies completely outside the pharynx. somatic nervous system   WBbt:0005760

0 Expression Clusters

1559 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Picture: FIG. 1D-G.   Expr4885 Expressed in a relatively broad range of tissues. Robustly expressed in vulval muscles, and modestly expressed in body wall muscles and in the pharynx. Expression of was also observed in the intestine and expression of asd-1 was observed in the nervous system. Widely expressed in the early embryos before morphogenesis.  
Picture: Fig. 6A, 6B. Reporter gene fusion type not specified.   Expr4829 Exclusively expressed throughout the nervous system in C. elegans. F25B3.3::gfp is a postmitotic pan-neuronal marker, i.e. its onset of expression is observed after the terminal division of neurons (around 450 minutes of embryonic development).  
Picture: Figure 2.   Expr4951 GLO-4::GFP showed a discrete punctate localization in many different tissues, including muscle, pharynx, gut, and nervous system.  
The large amounts of flanking DNA in the recombineered fusions may avoid artifactual expression potentially arising from fusions with incomplete promoters. The more tightly localized distribution of the fluorescent proteins may be because the product of the X-gal staining reaction, used to visualize -galactosidase, spreads from the source. However, the recombineered fusions result in the fluorescent tag being added to the terminus of a virtually intact C.elegans protein, and the fusion protein may then show a subcellular distribution more tightly reflecting the distribution of the endogenous protein.   Expr4241 GFP and CFP expression patterns observed for F40E10.6 reporter fusions generated by fosmid recombineering were strong and clear, restricted to the nervous system, from the circumpharyngeal nerve ring in the head, down the nerve cord, around the vulva, to the tail ganglia. No expression could be detected in the pharynx.  
Strain: BC10524 [C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'. Expr5296 Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons;  
Also expressed in (comments from author) : unidentified cells in head and near vulva. Strain: BC10721 [C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'. Expr5297 Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;  
Strain: BC10900 [C18A3.5a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTCGTTCATAATGCTGCG] 3' and primer B 5' [TGAAGAAGGAGATGGCTTAAATG] 3'. Expr5298 Adult Expression: pharynx; Nervous System; head neurons; Larval Expression: pharynx; intestine; Nervous System; head neurons; tail neurons;  
Also expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product. Strain: BC10173 [C17G10.9a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGAAGATATGCCTTCTAGG] 3' and primer B 5' [CGCGTCGAGAGATTACTGAA] 3'. Expr5291 Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ;  
Also expressed in (comments from author) : Neural in tail are the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). Strain: BC13998 [C17H11.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTAAAAATGTTTGCGCCG] 3' and primer B 5' [CGTCGCTGTATGACCAACC] 3'. Expr5292 Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; uterus; vulva other; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ;  
Also expressed in (comments from author) : No comments. Strain: BC15588 [C17H12.13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCAAACAATTCCAGCAAATTA] 3' and primer B 5' [TTCGCAGTGATATCTGGAAAATTA] 3'. Expr5294 Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons;  
Also expressed in (comments from author) : Head neurons are mechanosensory, possibly the CEP sensilla. Strain: BC10478 [C17E4.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGACTAGGCGACGATGA] 3' and primer B 5' [TTATCGCTGATAATGTGAACGAGT] 3'. Expr5285 Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons; tail neurons; unidentified cells; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons;  
Also expressed in (comments from author) : No comments. Strain: BC16202 [srz-67::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGCAGTTACTGTCCCCTTA] 3' and primer B 5' [AGCAATTGATTTCAAACTCGC] 3'. Expr5286 Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons;  
Also expressed in (comments from author) : No comments. Strain: BC11855 [C17G10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGTTCCCTAGAAGCATTGGC] 3' and primer B 5' [TCTTCCAGATAAAAACCATCGG] 3'. Expr5288 Adult Expression: intestine; Larval Expression: intestine; Nervous System; head neurons;  
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10522 [C17G10.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCCGACTCGAGGAACTGT] 3' and primer B 5' [CTGGGGAAGATCGATTGGT] 3'. Expr5289 Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; head neurons; Larval Expression: pharynx; body wall muscle; Nervous System; head neurons;  
Strain: BC10891 [C16C10.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAGCAGATTTTTGGAATTTTCAC] 3' and primer B 5' [GCCGTTTTGATGCGATCT] 3'. Expr5280 Adult Expression: intestine; Nervous System; head neurons; Larval Expression: intestine; Nervous System; head neurons;  
Also expressed in (comments from author) : Notes have been lost. 2 images taken and posted, appears neural. Strain: BC10763 [ceh-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCAGTATCCTCTGCATCGGT] 3' and primer B 5' [GTATCGGCAGAAGGGATAGTTG] 3'. Expr5281 Larval Expression: Nervous System; nerve ring; head neurons;  
Strain: BC13820 [rol-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGAAAACTCGTTCCATCATT] 3' and primer B 5' [GTCGTCATGTACAGGCTGTCT] 3'. Expr5283 Adult Expression: hypodermis; Nervous System; head neurons; Larval Expression: hypodermis; Nervous System; head neurons;  
Strain: BC10379 [C16A3.10a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGGCTTTTGGTTGCAATTT] 3' and primer B 5' [GAGGGAGGACAAGATTCTGC] 3'. Expr5273 Adult Expression: intestine; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: intestine; Nervous System; head neurons; unidentified cells in tail ;  
Also expressed in (comments from author) : Mosaic population. Strain: BC14096 [C16C10.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTTATCGCTTTCAATTTGACT] 3' and primer B 5' [GCGAGCTGTGATTTCTGGA] 3'. Expr5276 Adult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; Nervous System; head neurons; amphids; unidentified cells in tail ; Larval Expression: anal depressor muscle; Nervous System; head neurons; amphids; unidentified cells in tail ;  
Strain: BC15643 [tag-73::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTTATCGCTTTCAATTTGACT] 3' and primer B 5' [GCGAGCTGTGATTTCTGGA] 3'. Expr5277 Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; Reproductive System; vulval muscle; seam cells; Nervous System; head neurons; amphids; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal sphincter; seam cells; Nervous System; head neurons; amphids;  
Also expressed in (comments from author) : No comments. Strain: BC14394 [C16C10.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGTGCAATCGTGGTAGGATTT] 3' and primer B 5' [CCGACGAACGATTTTCTGA] 3'. Expr5278 Adult Expression: pharynx; anal depressor muscle; body wall muscle; Nervous System; head neurons; tail neurons; Larval Expression: pharynx; anal depressor muscle; body wall muscle; Nervous System; head neurons; tail neurons;  
Also expressed in (comments from author) : No comments. Strain: BC14128 [C16C10.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGCCATATTGGTAGCTGTGG] 3' and primer B 5' [GACCGTTGCTGATTTTTCTGA] 3'. Expr5279 Adult Expression: pharynx; anal depressor muscle; rectal epithelium; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; tail neurons;  
Strain: BC10466 [nnt-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCCCCTCATTGATTGTGATCT] 3' and primer B 5' [CGAAGAATGACGATGCTGAA] 3'. Expr5271 Adult Expression: pharyngeal-intestinal valve; intestine; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharyngeal-intestinal valve; intestine; hypodermis; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;  
Also expressed in (comments from author) : Intestinal expression is mosaic. Strain: BC10066 [hsp-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCAACAAACGAATAATAG] 3' and primer B 5' [tttgtgtttgatttattttcctg] 3'. Expr5272 Adult Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; coelomocytes; Nervous System; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; Nervous System; head neurons; tail neurons; unidentified cells in tail ;  
Also expressed in (comments from author) : Head neurons are possibly the ring interneurons (RIF and RIG) Strain: BC12233 [ceh-16::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATACCACAAGTTTTTGGCCG] 3' and primer B 5' [CTAAGGAAGCTCCGCCTCTT] 3'. Expr5262 Adult Expression: Nervous System; head neurons; Larval Expression: seam cells; Nervous System; head neurons;  
Also expressed in (comments from author) : low intensity GFP in unidentified cells. Strain: BC12234 [ceh-16::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATACCACAAGTTTTTGGCCG] 3' and primer B 5' [CTAAGGAAGCTCCGCCTCTT] 3'. Expr5263 Adult Expression: seam cells; Nervous System; head neurons; unidentified cells in head; Larval Expression: seam cells; Nervous System; head neurons; unidentified cells in head;  
Also expressed in (comments from author) : Mosaic population. Strain: BC13892 [C14A4.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGAATTTATAGAAAATGGCAGT] 3' and primer B 5' [ATTGTGAAACTGCTGAAATGAAAA] 3'. Expr5265 Adult Expression: intestine; Reproductive System; uterus; vulva other; spermatheca uterine valve; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; Reproductive System; developing gonad; developing vulva; developing uterus; hypodermis; excretory cell; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ;  
Strain: BC12527 [C15C7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATTTCAAAATTTCGCCTGAAAA] 3' and primer B 5' [TCGGTAGTTGCTGATTTTCACTAT] 3'. Expr5267 Adult Expression: pharynx; intestine; Nervous System; head neurons; unidentified cells in head; Larval Expression: pharynx; intestine; Nervous System; head neurons; unidentified cells in head;  
Also expressed in (comments from author) : Unidentified in head might be amphid socket cells?Embryo incomplete. To be updated. Strain: BC10468 [C15C7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TATTTCAAAATTTCGCCTGAAAA] 3' and primer B 5' [TCGGTAGTTGCTGATTTTCACTAT] 3'. Expr5268 Adult Expression: intestine; anal sphincter; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head; Larval Expression: intestine; anal sphincter; rectal epithelium; seam cells; Nervous System; head neurons; tail neurons; unidentified cells in head;  
Also expressed in (comments from author) : Pharyngeal neuron is probably I3 (Hall Lab, 2005). Strain: BC11857 [klp-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAACGAATGACCCACTTCTC] 3' and primer B 5' [CTTTTTCCTTGAAGATTTCCAACT] 3'. Expr5269 Adult Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head; Larval Expression: pharynx; anal sphincter; rectal epithelium; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; unidentified cells in head;  

0 Life Stages

1 Parents

Definition Name Synonym Primary Identifier
intergrated group of organs, performing one or more unified functions. Organ system   WBbt:0005746