WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: Nervous System; nerve ring; head neurons; Primary Identifier  Expr5281
Remark  Also expressed in (comments from author) : Notes have been lost. 2 images taken and posted, appears neural. Strain: BC10763 Reporter Gene  [ceh-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCAGTATCCTCTGCATCGGT] 3' and primer B 5' [GTATCGGCAGAAGGGATAGTTG] 3'.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000430 ceh-5 C16C2.1 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023