WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Anatomy Term :

Definition  neurons that sense body touch, have specialized microtubules in processes. Name  touch receptor neuron
Primary Identifier  WBbt:0005237 Synonym  microtubule cell

4 Children

Definition Name Synonym Primary Identifier
Neuron class of one sensory neuron, anterior ventral microtubule cell, touch receptor. AVM lineage name: QR.paa WBbt:0003832
Neuron class of one neuron, posterior ventral microtuble cell, touch receptor. PVM lineage name: QL.paa WBbt:0004086
Neuron class of two anterior sensory neurons that transduce touch stimuli. ALM   WBbt:0005406
Neuron class of two posterior sensory neurons that transduce touch stimuli. PLM   WBbt:0005490

8 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes that showed decreased expression in polyQ-expanded hungtingtin (HTT) 128Q touch receptor cells comparing to in 19Q touch receptor cells. Authors performed the statistial analysis of the microarray data using the Varmixt tool of the R package, with VM parameters and FDR corrections of P-Values. WBPaper00045417:128Q-huntingtin_downreglated
  Genes that showed increased expression in normal huntingtin (HTT) expressing 19Q touch receptor cells comparing to in GFP-only touch receptor cells. Authors performed the statistial analysis of the microarray data using the Varmixt tool of the R package, with VM parameters and FDR corrections of P-Values. WBPaper00045417:19Q-huntingtin_upreglated
  Genes that showed increased expression in polyQ-expanded hungtingtin (HTT) 128Q touch receptor cells comparing to in 19Q touch receptor cells. Authors performed the statistial analysis of the microarray data using the Varmixt tool of the R package, with VM parameters and FDR corrections of P-Values. WBPaper00045417:128Q-huntingtin_upreglated
  Genes that showed decreased expression in normal huntingtin (HTT) expressing 19Q touch receptor cells comparing to in GFP-only touch receptor cells. Authors performed the statistial analysis of the microarray data using the Varmixt tool of the R package, with VM parameters and FDR corrections of P-Values. WBPaper00045417:19Q-huntingtin_downreglated
  Transcripts that showed significanlty increased expression in touch receptor neurons in mec-8 (e398) animals comparing to in touch receptor neurons in N2 animals at L4 larva stage. N.A. WBPaper00062197:mec-8_upregulated_TRN
  Transcripts that showed significantly increased expression in touch receptor neurons comparing to in whole N2 animal at L4 larva stage. N.A. WBPaper00062197:TRN_enriched
  Transcripts that showed significanlty decreased expression in touch receptor neurons in mec-8 (e398) animals comparing to in touch receptor neurons in N2 animals at L4 larva stage. N.A. WBPaper00062197:mec-8_downregulated_TRN
  Transcripts that showed significantly decreased expression in touch receptor neurons comparing to in whole N2 animal at L4 larva stage. N.A. WBPaper00062197:TRN_depleted

90 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4870 A-class motor neuron: expressed in embryo; enriched in larva (1.6). Neuronal expression include: All ventral cord motor neurons, head neurons, touch neurons. Also expressed in other cells: Intestine, anal depressor, head muscle. Pan-neuronal: expressed in embryo and larva.  
    Expr4869 A-class motor neuron: enriched in embryo (3.6) and larva (3.1). Neuronal expression include: DA, DB, VA, VB, VC, touch neurons, head and tail neurons. Pan-neuronal: enriched in embryo (2.3) and larva (4.0).  
    Expr4852 A-class motor neuron: enriched in larva (1.8); not expressed in embryo. Neuronal expression include: All ventral cord motor neurons, head and tail neurons, touch neurons. Also expressed in other cells: Body muscle, anal depressor, sphincter muscle? Excretory gland cells?. Pan-neuronal: enriched in larva (3.2); not expressed in embryo.  
    Expr4854 A-class motor neuron: expressed in embryo; enriched in larva (1.6). Neuronal expression include: Posterior ventral cord motor neurons (VA, VB, DB, AS), head and tail neurons, touch neurons. Pan-neuronal: expressed in embryo; enriched in larva (3.0).  
    Expr4856 A-class motor neuron: expressed in embryo; enriched in larva (1.9). Neuronal expression include: L2 -- DA, VA, VB, VD, bright in touch neurons, head and tail neurons L3 -- all ventral cord motor neurons. Pan-neuronal: expressed in embryo; enriched in larva (5.9).  
    Expr4840 A-class motor neuron: expressed in embryo; not expressed in larva. Neuronal expression include: All ventral cord motor neurons, head and tail neurons, touch neurons. Also expressed in other cells: Intestine, vulval muscle, pharyngeal muscle, anal depressor, body muscle. Pan-neuronal: enriched in embryo (1.8); not expressed in larva.  
    Expr4556 Expressed in touch receptor neurons, ventral cord neurons and the nerve ring in the head. Expressed in the cell bodies and processes of neurons.
    Expr4557 Expressed in touch receptor neurons, ventral cord neurons and the nerve ring in the head. Expressed in the cell bodies and processes of neurons.
Also expressed in (comments from author) : Head neurons are mechanosensory, possibly the CEP sensilla. Strain: BC10478 [C17E4.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGACTAGGCGACGATGA] 3' and primer B 5' [TTATCGCTGATAATGTGAACGAGT] 3'. Expr5285 Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons; tail neurons; unidentified cells; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons;  
Strain: BC13645 [C04F12.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCGGTTGCCTCTAATAGT] 3' and primer B 5' [GGTGTAGAAACCGGATCTGAAA] 3'. Expr5145 Adult Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons;  
Strain: BC12212 [sra-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGTGACCAAACTTCAGCAAA] 3' and primer B 5' [TTAAATTCTGCGAGTGCAGTTT] 3'. Expr5004 Adult Expression: Nervous System; head neurons; mechanosensory neurons; Larval Expression: Nervous System; head neurons; mechanosensory neurons;  
Strain: BC13336 [Y110A7A.20::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTAACGCCACGAAGACATT] 3' and primer B 5' [ATTCTTGTAATGCGAATGAGTCAA] 3'. Expr6881 Adult Expression: Nervous System; head neurons; amphids; mechanosensory neurons; phasmids; unidentified cells in tail ; Larval Expression: Nervous System; head neurons; amphids; mechanosensory neurons; phasmids; unidentified cells in tail ;  
    Expr15094 HSP-90 and the cochaperones DAF-41, STI-1, and PPH-5 are expressed in most C. elegans cells (Gillan et al., 2009; Richie et al., 2011; Song et al., 2009), and we confirmed their expression in the TRNs.  
Also expressed in (comments from author) : No comments. Strain: BC15411 [EEED8.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATTCCCCTTGTAGTTGTGCTC] 3' and primer B 5' [CAACATAGCCGATATTGAAAATGA] 3'. Expr5650 Adult Expression: Nervous System; head neurons; mechanosensory neurons; Larval Expression: Nervous System; head neurons; mechanosensory neurons;  
Strain: BC10950 [let-92::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATTGGTTGAGCAGTCAGA] 3' and primer B 5' [GGGGCAGCAGCGATACTA] 3'. Expr5997 Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; vulva other; body wall muscle; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; neurons along body; tail neurons; phasmids; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; neurons along body; tail neurons; phasmids;  
Strain: BC10829 [egl-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGGTCTCCTGGATTTTC] 3' and primer B 5' [TCCCAACCGGGATATTGTT] 3'. Expr5774 Adult Expression: Nervous System; nerve ring; head neurons; mechanosensory neurons; tail neurons; Larval Expression: Nervous System; nerve ring; head neurons; mechanosensory neurons; tail neurons;  
    Expr14945 We examined functional transgenes of full-length DCAP-1 or CGH-1 expressed under their respective promoters and observed expression in many neurons including TRNs and motor neurons, localizing to cytoplasmic puncta in neuronal cell bodies.  
Also expressed in (comments from author) : No comments. Strain: BC15619 [T01D3.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACCTTTTGGGAAGACGTACATT] 3' and primer B 5' [GAAGACGATATTTCGATTCCAGTT] 3'. Expr6563 Adult Expression: Nervous System; nerve ring; head neurons; mechanosensory neurons; tail neurons; Larval Expression: Nervous System; nerve ring; head neurons; mechanosensory neurons; tail neurons;  
Strain: BC15463 [R151.2b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGTATTCGCGGTTTTTCAG] 3' and primer B 5' [TTCTGAGATCTTCTTCGGATGAG] 3'. Expr6545 Adult Expression: intestine; Reproductive System; spermatheca; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; mechanosensory neurons; tail neurons; phasmids; Larval Expression: intestine; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; mechanosensory neurons; tail neurons; phasmids;  
Strain: BC12660 [R13A5.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCTTTGATCTTCAGTGTTTGG] 3' and primer B 5' [CCAACATGGTTCTCGATACC] 3'. Expr6526 Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons;  
Also expressed in (comments from author) : No comments. Strain: BC14834 [srab-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGCGACCTCAGTTTTTGAG] 3' and primer B 5' [TGTTTTGTCTGAAAATTCGGG] 3'. Expr6497 Adult Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids; Larval Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids;  
Strain: BC11102 [R02F2.1b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTTTTCCGCGTAGGTAGACTC] 3' and primer B 5' [GTCCTCGTTCATCCTGAGATTAGT] 3'. Expr6446 Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; mechanosensory neurons; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; mechanosensory neurons; tail neurons;  
Strain: BC15574 [M03E7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGCCACGAATTTAGCTTCTA] 3' and primer B 5' [GGTGGAGGACGAGATGGAT] 3'. Expr6414 Adult Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons;  
Strain: BC12154 [oct-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTCAATCGGAGTGAACTCAA] 3' and primer B 5' [TTGGTCATTCTTTCTTAAAGTCAA] 3'. Expr6140 Adult Expression: pharyngeal-intestinal valve; body wall muscle; Nervous System; head neurons; mechanosensory neurons; pharyngeal neurons; Larval Expression: pharyngeal-intestinal valve; intestine; body wall muscle; Nervous System; head neurons; mechanosensory neurons; pharyngeal neurons;  
Strain: BC14611 [ppk-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTGAAACCAATAAACCAGCCT] 3' and primer B 5' [GAAAGTTGCTTGTAAAAACACGG] 3'. Expr6189 Adult Expression: intestine; Reproductive System; vulva other; head mesodermal cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; Larval Expression: intestine; Reproductive System; developing vulva; head mesodermal cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons;  
Also expressed in (comments from author) : No comments. Strain: BC14979 [F57B10.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCTCATTCTCCATCTTGTCGT] 3' and primer B 5' [GAAGATTGCTGAAAATTTGACTGA] 3'. Expr6238 Adult Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids;  
Picture: N.A.   Marker10 Expressed in touch receptor neurons.  
    Expr11574 atat-2 is expressed not only in touch receptor neurons but also in a subset of ciliated neurons, namely, PDE, ADE, CEP, and OLQ.  
Picture: . Reporter gene fusion type not specified.   Marker72 Marker for touch receptor neurons.  
Strain: BC13105 [Y37E3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGCCGAATCTCAATTTTTACT] 3' and primer B 5' [CTTTTCGGTGATTTCTTCTCACTT] 3'. Expr6936 Adult Expression: Nervous System; nerve ring; head neurons; amphids; mechanosensory neurons; tail neurons; phasmids; unidentified cells in head; Larval Expression: Nervous System; nerve ring; head neurons; amphids; mechanosensory neurons; tail neurons; phasmids; unidentified cells in head;  

0 Life Stages

1 Parents

Definition Name Synonym Primary Identifier
neuron that senses and responds to mechanical stimuli, such as touch. mechanosensory neuron   WBbt:0008431