WormMine: AnatomyTerm WBbt:0005237

• Definition: neurons that sense body touch, have specialized microtubules in processes.
• Name: touch receptor neuron
• Primary Identifier: WBbt:0005237
• Synonym: microtubule cell

4 Children

Definition	Name	Synonym	Primary Identifier
Neuron class of one sensory neuron, anterior ventral microtubule cell, touch receptor.	AVM	lineage name: QR.paa	WBbt:0003832
Neuron class of one neuron, posterior ventral microtuble cell, touch receptor.	PVM	lineage name: QL.paa	WBbt:0004086
Neuron class of two anterior sensory neurons that transduce touch stimuli.	ALM		WBbt:0005406
Neuron class of two posterior sensory neurons that transduce touch stimuli.	PLM		WBbt:0005490

8 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes that showed decreased expression in polyQ-expanded hungtingtin (HTT) 128Q touch receptor cells comparing to in 19Q touch receptor cells.	Authors performed the statistial analysis of the microarray data using the Varmixt tool of the R package, with VM parameters and FDR corrections of P-Values.	WBPaper00045417:128Q-huntingtin_downreglated
	Genes that showed increased expression in normal huntingtin (HTT) expressing 19Q touch receptor cells comparing to in GFP-only touch receptor cells.	Authors performed the statistial analysis of the microarray data using the Varmixt tool of the R package, with VM parameters and FDR corrections of P-Values.	WBPaper00045417:19Q-huntingtin_upreglated
	Genes that showed increased expression in polyQ-expanded hungtingtin (HTT) 128Q touch receptor cells comparing to in 19Q touch receptor cells.	Authors performed the statistial analysis of the microarray data using the Varmixt tool of the R package, with VM parameters and FDR corrections of P-Values.	WBPaper00045417:128Q-huntingtin_upreglated
	Genes that showed decreased expression in normal huntingtin (HTT) expressing 19Q touch receptor cells comparing to in GFP-only touch receptor cells.	Authors performed the statistial analysis of the microarray data using the Varmixt tool of the R package, with VM parameters and FDR corrections of P-Values.	WBPaper00045417:19Q-huntingtin_downreglated
	Transcripts that showed significanlty increased expression in touch receptor neurons in mec-8 (e398) animals comparing to in touch receptor neurons in N2 animals at L4 larva stage.	N.A.	WBPaper00062197:mec-8_upregulated_TRN
	Transcripts that showed significantly increased expression in touch receptor neurons comparing to in whole N2 animal at L4 larva stage.	N.A.	WBPaper00062197:TRN_enriched
	Transcripts that showed significanlty decreased expression in touch receptor neurons in mec-8 (e398) animals comparing to in touch receptor neurons in N2 animals at L4 larva stage.	N.A.	WBPaper00062197:mec-8_downregulated_TRN
	Transcripts that showed significantly decreased expression in touch receptor neurons comparing to in whole N2 animal at L4 larva stage.	N.A.	WBPaper00062197:TRN_depleted

89 Expression Patterns

• Primary Identifier: Expr4870
• Pattern: A-class motor neuron: expressed in embryo; enriched in larva (1.6). Neuronal expression include: All ventral cord motor neurons, head neurons, touch neurons. Also expressed in other cells: Intestine, anal depressor, head muscle. Pan-neuronal: expressed in embryo and larva.

• Primary Identifier: Expr4869
• Pattern: A-class motor neuron: enriched in embryo (3.6) and larva (3.1). Neuronal expression include: DA, DB, VA, VB, VC, touch neurons, head and tail neurons. Pan-neuronal: enriched in embryo (2.3) and larva (4.0).

• Primary Identifier: Expr4852
• Pattern: A-class motor neuron: enriched in larva (1.8); not expressed in embryo. Neuronal expression include: All ventral cord motor neurons, head and tail neurons, touch neurons. Also expressed in other cells: Body muscle, anal depressor, sphincter muscle? Excretory gland cells?. Pan-neuronal: enriched in larva (3.2); not expressed in embryo.

• Primary Identifier: Expr4854
• Pattern: A-class motor neuron: expressed in embryo; enriched in larva (1.6). Neuronal expression include: Posterior ventral cord motor neurons (VA, VB, DB, AS), head and tail neurons, touch neurons. Pan-neuronal: expressed in embryo; enriched in larva (3.0).

• Primary Identifier: Expr4856
• Pattern: A-class motor neuron: expressed in embryo; enriched in larva (1.9). Neuronal expression include: L2 -- DA, VA, VB, VD, bright in touch neurons, head and tail neurons L3 -- all ventral cord motor neurons. Pan-neuronal: expressed in embryo; enriched in larva (5.9).

• Primary Identifier: Expr4840
• Pattern: A-class motor neuron: expressed in embryo; not expressed in larva. Neuronal expression include: All ventral cord motor neurons, head and tail neurons, touch neurons. Also expressed in other cells: Intestine, vulval muscle, pharyngeal muscle, anal depressor, body muscle. Pan-neuronal: enriched in embryo (1.8); not expressed in larva.

• Primary Identifier: Expr4556
• Pattern: Expressed in touch receptor neurons, ventral cord neurons and the nerve ring in the head.
• Subcellular Localization: Expressed in the cell bodies and processes of neurons.

• Primary Identifier: Expr4557
• Pattern: Expressed in touch receptor neurons, ventral cord neurons and the nerve ring in the head.
• Subcellular Localization: Expressed in the cell bodies and processes of neurons.

• Primary Identifier: Expr5285
• Remark: Also expressed in (comments from author) : Head neurons are mechanosensory, possibly the CEP sensilla. Strain: BC10478
• Reporter Gene: [C17E4.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAGACTAGGCGACGATGA] 3' and primer B 5' [TTATCGCTGATAATGTGAACGAGT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons; tail neurons; unidentified cells; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons

• Primary Identifier: Expr5145
• Remark: Strain: BC13645
• Reporter Gene: [C04F12.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCGGTTGCCTCTAATAGT] 3' and primer B 5' [GGTGTAGAAACCGGATCTGAAA] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons

• Primary Identifier: Expr5004
• Remark: Strain: BC12212
• Reporter Gene: [sra-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGTGACCAAACTTCAGCAAA] 3' and primer B 5' [TTAAATTCTGCGAGTGCAGTTT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; mechanosensory neurons; Larval Expression: Nervous System; head neurons; mechanosensory neurons

• Primary Identifier: Expr6881
• Remark: Strain: BC13336
• Reporter Gene: [Y110A7A.20::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTAACGCCACGAAGACATT] 3' and primer B 5' [ATTCTTGTAATGCGAATGAGTCAA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; mechanosensory neurons; phasmids; unidentified cells in tail ; Larval Expression: Nervous System; head neurons; amphids; mechanosensory neurons; phasmids; unidentified cells in tail

• Primary Identifier: Expr15094
• Pattern: HSP-90 and the cochaperones DAF-41, STI-1, and PPH-5 are expressed in most C. elegans cells (Gillan et al., 2009; Richie et al., 2011; Song et al., 2009), and we confirmed their expression in the TRNs.

• Primary Identifier: Expr5650
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15411
• Reporter Gene: [EEED8.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GATTCCCCTTGTAGTTGTGCTC] 3' and primer B 5' [CAACATAGCCGATATTGAAAATGA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; mechanosensory neurons; Larval Expression: Nervous System; head neurons; mechanosensory neurons

• Primary Identifier: Expr5997
• Remark: Strain: BC10950
• Reporter Gene: [let-92::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATTGGTTGAGCAGTCAGA] 3' and primer B 5' [GGGGCAGCAGCGATACTA] 3'.
• Pattern: Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; vulva other; body wall muscle; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; neurons along body; tail neurons; phasmids; Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; neurons along body; tail neurons; phasmids

• Primary Identifier: Expr5774
• Remark: Strain: BC10829
• Reporter Gene: [egl-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCGGTCTCCTGGATTTTC] 3' and primer B 5' [TCCCAACCGGGATATTGTT] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; head neurons; mechanosensory neurons; tail neurons; Larval Expression: Nervous System; nerve ring; head neurons; mechanosensory neurons; tail neurons

• Primary Identifier: Expr14945
• Pattern: We examined functional transgenes of full-length DCAP-1 or CGH-1 expressed under their respective promoters and observed expression in many neurons including TRNs and motor neurons, localizing to cytoplasmic puncta in neuronal cell bodies.

• Primary Identifier: Expr6563
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15619
• Reporter Gene: [T01D3.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACCTTTTGGGAAGACGTACATT] 3' and primer B 5' [GAAGACGATATTTCGATTCCAGTT] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; head neurons; mechanosensory neurons; tail neurons; Larval Expression: Nervous System; nerve ring; head neurons; mechanosensory neurons; tail neurons

• Primary Identifier: Expr6545
• Remark: Strain: BC15463
• Reporter Gene: [R151.2b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGTATTCGCGGTTTTTCAG] 3' and primer B 5' [TTCTGAGATCTTCTTCGGATGAG] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; spermatheca; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; mechanosensory neurons; tail neurons; phasmids; Larval Expression: intestine; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; mechanosensory neurons; tail neurons; phasmids

• Primary Identifier: Expr6526
• Remark: Strain: BC12660
• Reporter Gene: [R13A5.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCTTTGATCTTCAGTGTTTGG] 3' and primer B 5' [CCAACATGGTTCTCGATACC] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons

• Primary Identifier: Expr6497
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14834
• Reporter Gene: [srab-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGCGACCTCAGTTTTTGAG] 3' and primer B 5' [TGTTTTGTCTGAAAATTCGGG] 3'.
• Pattern: Adult Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids; Larval Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids

• Primary Identifier: Expr6446
• Remark: Strain: BC11102
• Reporter Gene: [R02F2.1b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTTTTCCGCGTAGGTAGACTC] 3' and primer B 5' [GTCCTCGTTCATCCTGAGATTAGT] 3'.
• Pattern: Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; mechanosensory neurons; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; mechanosensory neurons; tail neurons

• Primary Identifier: Expr6414
• Remark: Strain: BC15574
• Reporter Gene: [M03E7.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGCCACGAATTTAGCTTCTA] 3' and primer B 5' [GGTGGAGGACGAGATGGAT] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons

• Primary Identifier: Expr6140
• Remark: Strain: BC12154
• Reporter Gene: [oct-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTCAATCGGAGTGAACTCAA] 3' and primer B 5' [TTGGTCATTCTTTCTTAAAGTCAA] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; body wall muscle; Nervous System; head neurons; mechanosensory neurons; pharyngeal neurons; Larval Expression: pharyngeal-intestinal valve; intestine; body wall muscle; Nervous System; head neurons; mechanosensory neurons; pharyngeal neurons

• Primary Identifier: Expr6189
• Remark: Strain: BC14611
• Reporter Gene: [ppk-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTGAAACCAATAAACCAGCCT] 3' and primer B 5' [GAAAGTTGCTTGTAAAAACACGG] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; vulva other; head mesodermal cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; Larval Expression: intestine; Reproductive System; developing vulva; head mesodermal cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons

• Primary Identifier: Expr6238
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14979
• Reporter Gene: [F57B10.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCTCATTCTCCATCTTGTCGT] 3' and primer B 5' [GAAGATTGCTGAAAATTTGACTGA] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids

• Primary Identifier: Marker10
• Remark: Picture: N.A.
• Pattern: Expressed in touch receptor neurons.

• Primary Identifier: Expr11574
• Pattern: atat-2 is expressed not only in touch receptor neurons but also in a subset of ciliated neurons, namely, PDE, ADE, CEP, and OLQ.

• Primary Identifier: Marker72
• Remark: Picture: . Reporter gene fusion type not specified.
• Pattern: Marker for touch receptor neurons.

• Primary Identifier: Expr6936
• Remark: Strain: BC13105
• Reporter Gene: [Y37E3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGCCGAATCTCAATTTTTACT] 3' and primer B 5' [CTTTTCGGTGATTTCTTCTCACTT] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; head neurons; amphids; mechanosensory neurons; tail neurons; phasmids; unidentified cells in head; Larval Expression: Nervous System; nerve ring; head neurons; amphids; mechanosensory neurons; tail neurons; phasmids; unidentified cells in head

0 Life Stages

1 Parents

Definition	Name	Synonym	Primary Identifier
neuron that senses and responds to mechanical stimuli, such as touch.	mechanosensory neuron		WBbt:0008431