WormMine: ExpressionPattern Expr6189

• Pattern: Adult Expression: intestine; Reproductive System; vulva other; head mesodermal cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; Larval Expression: intestine; Reproductive System; developing vulva; head mesodermal cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons
• Primary Identifier: Expr6189
• Remark: Strain: BC14611
• Reporter Gene: [ppk-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTGAAACCAATAAACCAGCCT] 3' and primer B 5' [GAAAGTTGCTTGTAAAAACACGG] 3'.

14 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
female genital.	vulva		WBbt:0006748
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neurons that sense body touch, have specialized microtubules in processes.	touch receptor neuron	microtubule cell	WBbt:0005237
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
neuron of the pharyngeal nervous system.	pharyngeal neuron		WBbt:0005439
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
a bundle of nerve processes that runs along the dorsal mid-line of the animal.	dorsal nerve cord	dorsal cord	WBbt:0006750
Head mesodermal cell, function unknown	head mesodermal cell	hmc	WBbt:0004697
nerve cord positioned at the lateral flanks of the animal, consists of processes of the neuron classes BDU, CAN, PVD and ALA.	lateral nerve cord		WBbt:0006769
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00004087	ppk-1	F55A12.3	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023