WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Life Stage :

Definition  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. Primary Identifier  WBls:0000023
Public Name  larva Ce

1 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733

2 Contained In

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins after hatching and ends when the nematode becomes adult. nematode larval stage WBls:0000105
  A developemental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until death. postembryonic Ce WBls:0000022

36 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_larva_enriched
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_larva_enriched
  Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:hypodermis_larva_SelectivelyEnriched
  WT-Pico Pan-neural Depleted Genes, with genes found multiple times in a single dataset removed (without dups). To identify differentially expressed transcripts, normalized intensity values from the pan-neural data sets were compared to a reference (from all larval cells) using Significance Analysis of Microarray software (SAM). A two class unpaired analysis of the data was performed to identify neuron-enriched genes. Pan-neural enriched transcripts in the IVT and WT-Pico-derived data set were defined as 1.5X elevated vs the reference at a False Discovery Rate (FDR) = 3%. WBPaper00031532:Larva_Pan_Neuronal_Depleted
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:excretory-cell_larva_enriched
  Larval Pan-neural Enriched Genes. A two-class unpaired analysis of the data was performed to identify genes that differ by >= 1.5-fold from the reference at a FDR of <1% for the larval pan-neural, embryonic pan-neural, and larval A-class motor neuron datasets. WBPaper00030839:Larval_Pan_Neuronal
  WT-Pico Pan-neural Enriched Genes, with genes found multiple times in a single dataset removed (without dups). To identify differentially expressed transcripts, normalized intensity values from the pan-neural data sets were compared to a reference (from all larval cells) using Significance Analysis of Microarray software (SAM). A two class unpaired analysis of the data was performed to identify neuron-enriched genes. Pan-neural enriched transcripts in the IVT and WT-Pico-derived data set were defined as 1.5X elevated vs the reference at a False Discovery Rate (FDR) = 3%. WBPaper00031532:Larva_Pan_Neuronal_Enriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_larva_enriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_larva_enriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at both embryonic and larval stages. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_CoreEnriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_larva_enriched
  Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_larva_SelectivelyEnriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_larva_enriched
  Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_larva_SelectivelyEnriched
  Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_larva_SelectivelyEnriched
  Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_larva_SelectivelyEnriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_larva_enriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_larva_enriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at both embryonic and larval stages. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:GABAergic-motor-neurons_CoreEnriched
  Larval A-class motor neuron enriched genes. A two-class unpaired analysis of the data was performed to identify genes that differ by >= 1.5-fold from the reference at a FDR of <1% for the larval pan-neural, embryonic pan-neural, and larval A-class motor neuron datasets. WBPaper00030839:Larval_A_Class
  Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_larva_SelectivelyEnriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at both embryonic and larval stages. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_CoreEnriched
  Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:dopaminergic-neurons_larva_SelectivelyEnriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_larva_enriched
  Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:intestine_larva_SelectivelyEnriched
  Genes that show selective expression in a subset of cell types vs broadly expressed in many cell types. Correspond to 20% - 57% of enriched_genes for a given cell type. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_larva_SelectivelyEnriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:GABAergic-motor-neurons_larva_enriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at both embryonic and larval stages. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_CoreEnriched
  Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at both embryonic and larval stages. A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:A-class-motor-neurons_CoreEnriched

2787 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4870 A-class motor neuron: expressed in embryo; enriched in larva (1.6). Neuronal expression include: All ventral cord motor neurons, head neurons, touch neurons. Also expressed in other cells: Intestine, anal depressor, head muscle. Pan-neuronal: expressed in embryo and larva.  
    Expr4863 A-class motor neuron: enriched in embryo (3.0) and larva (2.8). Neuronal expression include: Bright in anterior ventral cord neurons, weak and mosaic in posterior ventral cord. Also expressed in other cells: Pharyngeal/intestinal valves, hypodermis. Pan-neuronal: expressed in embryo; enriched in larva (1.8).  
    Expr4864 A-class motor neuron: enriched in embryo (2.0) and larva (2.1). Neuronal expression include: DA, DB, VA, VB, DD, VD, head neurons. Also expressed in other cells: Pharyngeal muscle. Pan-neuronal: enriched in embryo (1.7) and larva (3.5).  
    Expr4865 A-class motor neuron: enriched in embryo (1.8) and larva (1.8). Neuronal expression include: DA, DB, DD, VA, VB, VD, AS, head neurons. Also expressed in other cells: Head muscle. Pan-neuronal: enriched in embryo (1.8) and larva (1.5).  
    Expr4866 A-class motor neuron: enriched in embryo (2.1) and larva (1.9). Neuronal expression include: DA, DB, VA, VB. Pan-neuronal: enriched in embryo (1.9) and larva (2.2).  
    Expr4867 A-class motor neuron: enriched in embryo (5.3) and larva (3.7). Neuronal expression include: DA, DB, VA, VB, AS, head neurons. Also expressed in other cells: Body muscle, intestine. Pan-neuronal: enriched in embryo (3.9) and larva (8.3).  
    Expr4868 A-class motor neuron: enriched in embryo (5.1) and larva (1.7). Neuronal expression include: DA, DB, VA, VB, VD. Also expressed in other cells: Intestine, hypodermis. Pan-neuronal: enriched in embryo (1.9) and larva (2.7).  
    Expr4869 A-class motor neuron: enriched in embryo (3.6) and larva (3.1). Neuronal expression include: DA, DB, VA, VB, VC, touch neurons, head and tail neurons. Pan-neuronal: enriched in embryo (2.3) and larva (4.0).  
    Expr4860 A-class motor neuron: enriched in embryo (4.0) and larva (2.2). Neuronal expression include: DA, DB, VA, VB, head and tail neurons. Pan-neuronal: expressed in embryo; enriched in larva (2.3).  
    Expr4861 A-class motor neuron: enriched in embryo (6.3) and larva (2.5). Neuronal expression include: VA, head neurons. Also expressed in other cells: Intestine. Pan-neuronal: expressed in embryo; enriched in larva (3.1).  
    Expr4862 A-class motor neuron: enriched in embryo (1.9) and larva (2.1). Neuronal expression include: DA, VB, DB, VD, DD, bright in AS, also head and tail neurons. Pan-neuronal: expressed in embryo; enriched in larva (3.5).  
    Expr4852 A-class motor neuron: enriched in larva (1.8); not expressed in embryo. Neuronal expression include: All ventral cord motor neurons, head and tail neurons, touch neurons. Also expressed in other cells: Body muscle, anal depressor, sphincter muscle? Excretory gland cells?. Pan-neuronal: enriched in larva (3.2); not expressed in embryo.  
    Expr4853 A-class motor neuron: enriched in embryo (3.5) and larva (5.1). Neuronal expression include: All ventral cord neurons. Pan-neuronal: enriched in larva (2.1); not expressed in embryo.  
    Expr4854 A-class motor neuron: expressed in embryo; enriched in larva (1.6). Neuronal expression include: Posterior ventral cord motor neurons (VA, VB, DB, AS), head and tail neurons, touch neurons. Pan-neuronal: expressed in embryo; enriched in larva (3.0).  
    Expr4855 A-class motor neuron: enriched in embryo (1.9) and larva (1.6). Neuronal expression include: All neurons.. Pan-neuronal: expressed in embryo; enriched in larva (3.2).  
    Expr4856 A-class motor neuron: expressed in embryo; enriched in larva (1.9). Neuronal expression include: L2 -- DA, VA, VB, VD, bright in touch neurons, head and tail neurons L3 -- all ventral cord motor neurons. Pan-neuronal: expressed in embryo; enriched in larva (5.9).  
    Expr4857 A-class motor neuron: enriched in embryo (4.5) and larva (4.8). Neuronal expression include: All ventral cord neurons, head and tail neurons. Pan-neuronal: expressed in embryo; enriched in larva (3.5).  
    Expr4858 A-class motor neuron: enriched in embryo (2.8) and larva (3.1). Neuronal expression include: DA, VB, AS, DB, DD, HSN, VC4&5, AIY, head neurons. Also expressed in other cells: Muscle, intestine. Pan-neuronal: expressed in embryo; enriched in larva (1.5).  
    Expr4859 A-class motor neuron: enriched in embryo (8.7) and larva (7.9). Neuronal expression include: I5, ASE, ASG, BAG, DD, M3, M5, head neurons. Pan-neuronal: expressed in embryo; enriched in larva (7.1).  
    Expr4850 A-class motor neuron: enriched in embryo (2.6); not expressed in larva. Neuronal expression include: DD, head and tail neurons. Also expressed in other cells: Body muscle, pharyngeal muscle. Pan-neuronal: expressed in embryo; enriched in larva (6.5).  
    Expr4851 A-class motor neuron: enriched in embryo (1.7); not expressed in larva. Neuronal expression include: DA, VD, AS, VB, DB. Also expressed in other cells: Body muscle. Pan-neuronal: expressed in embryo; enriched in larva (2.7).  
    Expr4849 A-class motor neuron: expressed in larva; enriched in embryo (2.2). Pan-neuronal: enriched in larva (2.0); not expressed in embryo.  
    Expr4842 A-class motor neuron: enriched in embryo (2.9); not expressed in larva. Neuronal expression include: Weak in head and tail neurons, ventral cord. Also expressed in other cells: Pharynx, sheath cells, distal tip cell. Pan-neuronal: enriched in embryo (1.9); expressed in larva.  
    Expr4843 A-class motor neuron: expressed in larva; enriched in embryo (2.0). Neuronal expression include: Bright in head neurons, few tail neurons. weak in all ventral cord motor neurons. Touch neurons, PDE. Also expressed in other cells: Intestine, head muscle, pharyngeal muscle, hypodermis, distal tip cell. Pan-neuronal: expressed in larva; enriched in embryo(3.0).  
    Expr4844 A-class motor neuron: expressed in larva; enriched in embryo (2.4). Neuronal expression include: All ventral cord motor neurons, head and tail neurons. Pan-neuronal: expressed in larva; enriched in embryo (2.3).  
    Expr4845 A-class motor neuron: expressed in larva; enriched in embryo (2,5). Neuronal expression include: DA, DB, DD, VA, VB, VD, AS head and tail neurons. Also expressed in other cells: Body muscle, head muscle, pharyngeal muscle. Pan-neuronal: enriched in embryo (2.1) and larva (1.8).  
    Expr4846 A-class motor neuron: not expressed in embryo or larva. Neuronal expression include: All VNC motor neuron classes, except DD, head and tail neurons. Pan-neuronal: enriched in larva (4.9); not expressed in embryo.  
    Expr4847 A-class motor neuron: enriched in embryo (2.3); not expressed in larva. Neuronal expression include: DA, DB, DD, VD, AS. Pan-neuronal: enriched in larva (1.7); not expressed in embryo.  
    Expr4848 A-class motor neuron: expressed in larva; enriched in embryo (1.8). Neuronal expression include: VA, VB, DA, DB, AS, touch neurons. Also expressed in other cells: Body muscle, pharyngeal neurons. Pan-neuronal: enriched in larva (1.8); not expressed in embryo.  
Also expressed in (comments from author) : Mosaic population. Strain: BC10160 [vha-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAAATCCGCCTGAAAAATCA] 3' and primer B 5' [GATTCCGATGGCTACAGTCG] 3'. Expr5295 Adult Expression: Reproductive System; vulval muscle; hypodermis; excretory cell; unidentified cells in head; Larval Expression: hypodermis; excretory cell;  

1 Followed By

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041

1 Preceded By

Remark Definition Other Name Public Name Primary Identifier
  The whole period of embryogenesis in the nematode Caenorhabditis elegans, from the formation of an egg until hatching. embryo Ce WBls:0000003

14 Sub Stages

Remark Definition Other Name Public Name Primary Identifier
  The third stage larva. At 25 Centigrade, it ranges 32.5-40 hours after fertilization, 18.5-26 hours after hatch. L3 larva Ce WBls:0000035
  The second stage larva. At 25 Centigrade, it ranges 25.5-32.5 hours after fertilization, 11.5-18.5 hours after hatch. L2 larva Ce WBls:0000027
  The fourth stage larva. At 25 Centigrade, it ranges 40-49.5 hours after fertilization, 26-35.5 hours after hatch. L4 larva Ce WBls:0000038
  The first stage larva. At 25 Centigrade, it ranges 14-25.5 hours after fertilization, 0-11.5 hours after hatch. L1 larva Ce WBls:0000024
  A third stage larva specialized for dispersal and long term survival. dauer larva Ce WBls:0000032
  The stage when an animal shifts from L4 larva to adult. It includes the synthesis of new cuticle, cease of phrayngeal pumping during a lethargus stage, and the shed off of old cuticle. L4-adult molt Ce WBls:0000040
  The stage when an animal shifts from L2 larva to L3 larva. It includes the synthesis of new cuticle, cease of phrayngeal pumping during a lethargus stage, and the shed off of old cuticle. L2-L3 molt Ce WBls:0000029
  The stage when an animal shifts from L3 larva to L4 larva. It includes the synthesis of new cuticle, cease of phrayngeal pumping during a lethargus stage, and the shed off of old cuticle. L3-L4 molt Ce WBls:0000037
  The stage when an animal shifts from L1 larva to L2 larva. It includes the synthesis of new cuticle, cease of phrayngeal pumping during a lethargus stage, and the shed off of old cuticle. L1-L2 molt Ce WBls:0000026
  The stage when an animal shifts from L2d larva to dauer larva. It includes the synthesis of new cuticle, cease of pharyngeal pumping during a lethargus stage, and the shed off of old cuticle. L2d-dauer molt Ce WBls:0000031
  A special second stage larva with altered physiology and developmental potential that leads to formation of dauer larva. At 25 Centigrade, it ranges 25.5-32.5 hours after fertilization, 11.5-18.5 hours after hatch. L2d larva Ce WBls:0000046
  The stage when an animal shifts from L1 larva to L2d larva. It includes the synthesis of new cuticle, cease of phrayngeal pumping during a lethargus stage, and the shed off of old cuticle. L1-L2d molt Ce WBls:0000043
  A C. elegans L4 larval life stage that occurs after the animal has recovered from the dauer diapause. post dauer L4 stage Ce WBls:0000828
  The stage right after an animal recovered from dauer but has not started transformation to L4 larva yet. post dauer L3 stage Ce WBls:0000052