WormMine: AnatomyTerm WBbt:0005788

• Definition: Secretory gland cell of the pharynx
• Name: Pharyngeal gland cell
• Primary Identifier: WBbt:0005788

2 Children

Definition	Name	Synonym	Primary Identifier
Pharyngeal gland cell 2.	G2		WBbt:0003710
Pharyngeal gland cell 1.	G1		WBbt:0003712

2 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Single-cell RNA-Seq cell group 78_0 expressed in gland.	scVI 0.6.0	WBPaper00065841:78_0
	Single-cell RNA-Seq cell group 41_1 expressed in epithelium.	scVI 0.6.0	WBPaper00065841:41_1

133 Expression Patterns

• Primary Identifier: Expr4833
• Remark: Picture: Figure 1D, I and II.
• Pattern: The promoter extracted from B0336.3 is able to drive GFP expression in hypodermis, pharyngeal gland cell, gut, and nerve ring.

• Primary Identifier: Expr4764
• Pattern: CO3H5.2 gene has a broad expression pattern. This includes expression in the pharynx and pharyngeal gland cells, seam cells, spermatheca, stomatointestinal muscle, vulva and body wall muscle.

• Primary Identifier: Expr4395
• Pattern: The pps-1p::EGFP reporter is widely but tissue-specifically expressed in somatic cells. pps-1p::EGFP is strongly expressed in seam cells, gland cells, and neuronal support cells (amphid sheath cells) throughout development. Relatively weak expression was also detected in the hypodermis and the phasmid support cells during larval development. Additionally, weak expression was observed in the intestine at the adult stage. No signal was found in the neurons and muscles.

• Primary Identifier: Expr4396
• Pattern: The tissues expressing pps-1(FL)::EGFP and the timing of its expression were almost identical to those expressing pps-1p::EGFP. See Expr4395
• Subcellular Localization: pps-1(FL)::EGFP is dominantly localized in nuclei of all expressing cells.

• Primary Identifier: Expr5290
• Remark: Also expressed in (comments from author) : Unidentlified cells in head Strain: BC12669
• Reporter Gene: [C17G10.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCCGACTCGAGGAACTGT] 3' and primer B 5' [CTGGGGAAGATCGATTGGT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; Reproductive System; vulval muscle; body wall muscle; unidentified cells in head; Larval Expression: pharynx; pharyngeal gland cells; intestine; body wall muscle; unidentified cells in head

• Primary Identifier: Expr5272
• Remark: Also expressed in (comments from author) : Intestinal expression is mosaic. Strain: BC10066
• Reporter Gene: [hsp-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCAACAAACGAATAATAG] 3' and primer B 5' [tttgtgtttgatttattttcctg] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; coelomocytes; Nervous System; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; stomato-intestinal muscle; Nervous System; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr5255
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC15987
• Reporter Gene: [srr-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCAATTGCATGTTTCAATGC] 3' and primer B 5' [TGGAGTAATGATTGTTGAAAAAG] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; excretory cell; Nervous System; head neurons; Larval Expression: pharyngeal gland cells; intestine; excretory cell; Nervous System; head neurons

• Primary Identifier: Expr5256
• Remark: Strain: BC15141
• Reporter Gene: [srr-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGCCGCATCATCTTTTTC] 3' and primer B 5' [GGACTTGGAGTAATGATTGTTGAA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; vulva other; excretory cell; Nervous System; head neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; excretory cell; Nervous System; head neurons

• Primary Identifier: Expr5249
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC12650
• Reporter Gene: [C13B9.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTATGACAAAATTTCTACGCGA] 3' and primer B 5' [CGGCGATCAACACGATTG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; body wall muscle; Larval Expression: pharynx; pharyngeal gland cells; intestine; body wall muscle

• Primary Identifier: Expr5232
• Remark: Strain: BC14110
• Reporter Gene: [C10E2.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGACAACACATTTTTCTCACATTG] 3' and primer B 5' [CTGGTGCACCTGTGATTTTCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharyngeal gland cells; arcade cells; intestine; Reproductive System; distal tip cell; developing gonad; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5192
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15491
• Reporter Gene: [C06G3.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAATTTTTGTAGAAAGTGTGGG] 3' and primer B 5' [TTTGTCGATTTTGAACTTGGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr5186
• Remark: Strain: BC11648
• Reporter Gene: [nhr-50::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGAATATCAAGAGAGGGCGA] 3' and primer B 5' [GTAGATCAGCTGAAAGTGCAGAGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Nervous System; head neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Nervous System; head neurons; unidentified cells in tail

• Primary Identifier: Expr5187
• Remark: Also expressed in (comments from author) : High intensity GFP.Mosaic population. Strain: BC10396
• Reporter Gene: [C06E7.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCACAGTGATAGGTACGAGTTCA] 3' and primer B 5' [GCGAGATTTTGTTTGGTTGTAAG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; body wall muscle; seam cells; Nervous System; nerve ring; head neurons; unidentified cells; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; seam cells; Nervous System; nerve ring; head neurons; unidentified cells

• Primary Identifier: Expr5176
• Remark: Also expressed in (comments from author) : GLR head neurons are expressing (Hall Lab, 2005). Strain: BC14109
• Reporter Gene: [snx-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAAAACTGAAGGTTGGTTGT] 3' and primer B 5' [CTTCCGACAAGATTTCCAGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; Reproductive System; spermatheca uterine valve; head mesodermal cell; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; head mesodermal cell; coelomocytes; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5136
• Remark: Strain: BC14237
• Reporter Gene: [C03H5.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGCATTTTCCATTTTCGTC] 3' and primer B 5' [TCGTTAGCTCGATTGATGG] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5485
• Remark: Strain: BC15358
• Reporter Gene: [rpl-34::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTCGATGAGACATTTCCGA] 3' and primer B 5' [TAACGCGGAGGGAGATTTTT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; uterus; uterine muscle; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; hypodermis; excretory cell; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5473
• Remark: Strain: BC15639
• Reporter Gene: [C38H2.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGGTTACCTTTCTTGTTCAGA] 3' and primer B 5' [AACCGTCTCTTGATTTCTCATTTC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; vulva other; spermatheca; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; Nervous System; head neurons; unidentified cells in body ;unidentified cells in tail

• Primary Identifier: Expr5453
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11439
• Reporter Gene: [tbb-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAAACATATCGAGGCTGAAAATC] 3' and primer B 5' [TTGCTGAAAAGGTCGTAATGAAT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; Reproductive System; uterus; vulva other; spermatheca uterine valve; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; Reproductive System; developing vulva; developing uterus; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5528
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16377
• Reporter Gene: [trs-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATTTCGCGAAGTGACGC] 3' and primer B 5' [AACAGTTCAATCGGATCTAACGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; body wall muscle; Larval Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; body wall muscle

• Primary Identifier: Expr5529
• Remark: Strain: BC14006
• Reporter Gene: [C47D12.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATACCGCAGCTACAGCTTTGA] 3' and primer B 5' [GTTTCGATCTGAAAAGTTTGCC] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; Larval Expression: pharyngeal gland cells; intestine

• Primary Identifier: Expr5503
• Remark: Strain: BC14330
• Reporter Gene: [C44H4.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGTAAGGTGTCGAACAGGG] 3' and primer B 5' [TTATTGACGTGATCTTCGGTGT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; Reproductive System; vulval muscle; Nervous System; ventral nerve cord; unidentified cells in head; Larval Expression: pharynx; pharyngeal gland cells; intestine; Nervous System; ventral nerve cord; unidentified cells in head

• Primary Identifier: Expr5504
• Remark: Also expressed in (comments from author) : Mosaic tissue expression. Strain: BC13737
• Reporter Gene: [tap-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGGCTTTCATAAACGGAT] 3' and primer B 5' [TGTGCTCTGCGACTGCTC] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; body wall muscle; excretory cell; Nervous System; nerve ring; head neurons; unidentified cells; Larval Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; head neurons; unidentified cells

• Primary Identifier: Expr5394
• Remark: Strain: BC14389
• Reporter Gene: [C30H7.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGTGTCACCTGAAATGTTCGTT] 3' and primer B 5' [CCACCGCAGGATTTCTGA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; Nervous System; nerve ring; ventral nerve cord; head neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; developing vulva; developing spermatheca; Nervous System; nerve ring; ventral nerve cord; head neurons

• Primary Identifier: Expr5373
• Remark: Also expressed in (comments from author) : No comment. Strain: BC12749
• Reporter Gene: [npp-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGAAACATCCATGTCCGAG] 3' and primer B 5' [TGATTTTCGATTTTCATTATTCAT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; Larval Expression: pharyngeal gland cells

• Primary Identifier: Expr5375
• Remark: Strain: BC12840
• Reporter Gene: [C29E4.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGCAGTTTCTCTGGGAACG] 3' and primer B 5' [TCGGGACTCCGATAGCTG] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; hypodermis; unidentified cells in head; unidentified cells in tail ; Embryo Expression: hypodermis; Larval Expression: pharyngeal gland cells; intestine; Reproductive System; developing vulva; hypodermis; seam cells; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5338
• Remark: Strain: BC12726
• Reporter Gene: [C26C6.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGACAAATCTCATGGACAAAA] 3' and primer B 5' [TGATTGAGTCTGAAAACGGAAATA] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; vulva other; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5328
• Remark: Strain: BC13601
• Reporter Gene: [nas-12::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCGGTTAATAATACTTCAATACA] 3' and primer B 5' [GCGATTTTATACCAACGGACA] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; Larval Expression: pharyngeal gland cells; intestine; rectal gland cells

• Primary Identifier: Expr5318
• Remark: Strain: BC14065
• Reporter Gene: [C23H4.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTGCAAAAATAGACGTTGAACC] 3' and primer B 5' [GATCACGCCTAAAATTGATGGT] 3'.
• Pattern: Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; distal tip cell; spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; neurons along body; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal gland cells; Reproductive System; developing vulva; developing spermatheca; gonad sheath cells; head mesodermal cell; Nervous System; head neurons; neurons along body; unidentified cells in tail

• Primary Identifier: Expr5064
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC14242
• Reporter Gene: [B0403.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCGTGAAAATTATCAAAACTTCG] 3' and primer B 5' [AGCCATGACGATCCACTAATCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; Reproductive System; uterine-seam cell; excretory gland cells; coelomocytes; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; excretory gland cells; coelomocytes; unidentified cells in head; unidentified cells in tail

• Primary Identifier: Expr5065
• Remark: Also expressed in (comments from author) : Neural in tails is the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). Strain: BC13607
• Reporter Gene: [B0403.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCGTGAAAATTATCAAAACTTCG] 3' and primer B 5' [AGCCATGACGATCCACTAATCT] 3'.
• Pattern: Adult Expression: pharyngeal gland cells; intestine; Nervous System; tail neurons; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; intestine; body wall muscle; hypodermis

0 Life Stages

2 Parents

Definition	Name	Synonym	Primary Identifier
	pharyngeal cell		WBbt:0005460
A variety of very different cell types which share cytoplasmic features (such as large membrane-bound granules) that suggest a role in secretion, thus termed gland cells.	gland cell		WBbt:0003670