WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: hypodermis; Larval Expression: hypodermis; amphid socket cells; Primary Identifier  Expr5178
Remark  Strain: BC15183 Reporter Gene  [srp-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCTTGGTTTTGAAATTTTGG] 3' and primer B 5' [CGGACATTGTCGGAAAATTATG] 3'.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
Amphid socket cell, left AMsoL lineage name: ABplpaapapa WBbt:0003931
Amphid socket cell, right AMsoR lineage name: ABprpaapapa WBbt:0003929

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00005643 srp-2 C05E4.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023