WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: excretory cell; Nervous System; head neurons; tail neurons; Primary Identifier  Expr5490
Remark  Also expressed in (comments from author) : expression only in embryo through L2 Strain: BC13137 Reporter Gene  [dyf-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCTTGCTTGACTAGATTCCC] 3' and primer B 5' [GCCACAATTGATTGATACTTGAA] 3'.

4 Anatomy Terms

Definition Name Synonym Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001123 dyf-7 C43C3.3 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023