WormMine: ExpressionPattern Expr5491

• Pattern: Adult Expression: seam cells; Nervous System; nerve ring; head neurons; Larval Expression: seam cells; Nervous System; nerve ring; head neurons
• Primary Identifier: Expr5491
• Remark: Strain: BC15137
• Reporter Gene: [dyf-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCTTGCTTGACTAGATTCCC] 3' and primer B 5' [GCCACAATTGATTGATACTTGAA] 3'.

4 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail	seam cell	lateral hypodermis	WBbt:0005753
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00001123	dyf-7	C43C3.3	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023