WormMine: ExpressionPattern Expr5523

• Pattern: Adult Expression: Nervous System; head neurons; amphids; labial sensilla; neurons along body; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; labial sensilla; neurons along body; tail neurons; phasmids
• Primary Identifier: Expr5523
• Remark: Also expressed in (comments from author) : IL1 + IL2 labial neurons (Thomas Lab 2005). Good expression. Strain: BC12597
• Reporter Gene: [C47A10.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTCTGCCAAAACAAGGAAA] 3' and primer B 5' [CCTGGGAGCCAGTGATTCT] 3'.

7 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
neuron of phasmid sensillum	phasmid neuron		WBbt:0006753
neuron of the amphid sensillum	amphid neuron	amphid sensory neuron	WBbt:0005394
sensillum of inner or outer labial.	labial sensillum		WBbt:0005107

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00008128	srab-12	C47A10.6	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023