WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Nervous System; amphids; Larval Expression: Nervous System; amphids; Primary Identifier  Expr5407
Remark  Also expressed in (comments from author) : No comments. Strain: BC10069 Reporter Gene  [ceh-31::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGAGTTGCCGAAGATTTGA] 3' and primer B 5' [CAAAGGATGATAATTGGTTGACCT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron of the amphid sensillum amphid neuron amphid sensory neuron WBbt:0005394

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000452 ceh-31 C33D12.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023