WormMine: ExpressionPattern Expr5709

• Pattern: Adult Expression: Nervous System; Larval Expression: pharynx; Nervous System
• Primary Identifier: Expr5709
• Remark: Also expressed in (comments from author) : Variable punctate expression in what appears to be amphid sheath cells in nose tip. Does not appear to be neuronal expression (Hobert Lab apr 2005) Strain: BC13458
• Reporter Gene: [str-108::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAACACTTTCCATGGTGGC] 3' and primer B 5' [AGAAGAGCAGATCCTGAAGGTG] 3'.

2 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00006160	str-108	F10A3.13	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023