WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Nervous System; Larval Expression: pharynx; Nervous System; Primary Identifier  Expr5709
Remark  Also expressed in (comments from author) : Variable punctate expression in what appears to be amphid sheath cells in nose tip. Does not appear to be neuronal expression (Hobert Lab apr 2005) Strain: BC13458 Reporter Gene  [str-108::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAACACTTTCCATGGTGGC] 3' and primer B 5' [AGAAGAGCAGATCCTGAAGGTG] 3'.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00006160 str-108 F10A3.13 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023