WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulval muscle; unidentified cells in head; Primary Identifier  Expr5555
Remark  Strain: BC12133 Reporter Gene  [C50E10.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATTGCCAAAATAATTGGAAAAA] 3' and primer B 5' [GGTGGGTCGCTGAAAAGTT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00016831 sre-56 C50E10.8 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041