WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; Larval Expression: pharynx; Primary Identifier  Expr5643
Remark  Strain: BC14365 Reporter Gene  [E02D9.1b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAGATGTTTGCAAATTTTCCATT] 3' and primer B 5' [TGGGTCGATTATGACTGTGAG] 3'.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00017098 E02D9.1 E02D9.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023