WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; spermatheca; Primary Identifier  Expr5613
Remark  Strain: BC10999 Reporter Gene  [D1054.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGTTCTCCACTGTGGTTTGC] 3' and primer B 5' [GAAGATTCAGATGGATTTTCGG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00008370 D1054.1 D1054.1 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041