WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: unidentified cells in body ; Primary Identifier  Expr5961
Remark  Also expressed in (comments from author) : unidentified expression around developing vulva in larva Strain: BC12704 Reporter Gene  [smc-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTTCAAGACAATCCCCAA] 3' and primer B 5' [GAAGTCTTCGGAGGGATCAAC] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
region of the body by which tissues, cells or cell parts are classified body region   WBbt:0005738

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00004874 smc-4 F35G12.8 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023