WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: arcade cells; Primary Identifier  Expr5936
Remark  Strain: BC15244 Reporter Gene  [grl-13::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTGCCTTTTTCTTGCAT] 3' and primer B 5' [CAATGCTAAAGCTAAATGCCG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
Interfacial (hypodermal) cells which connect the hypodermal epithelium of the lips to the pharyngeal epithelium, firmly binding the inner tissue (the pharynx) to the outer bodywall (the hypodermis). arcade cell   WBbt:0005793

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001722 grl-13 F32D1.4 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023