WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: pharynx; hypodermis; Primary Identifier  Expr5901
Remark  Also expressed in (comments from author) : low intensity GFPMosaic population. Strain: BC13958 Reporter Gene  [F28D1.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATTCCGGGAGCGAATACTT] 3' and primer B 5' [GTGACAACCAGTCGATAGGGA] 3'.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00009212 atz-1 F28D1.2 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023