WormMine: ExpressionPattern Expr5770

• Pattern: Larval Expression: pharynx; Nervous System; head neurons; amphids
• Primary Identifier: Expr5770
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15938
• Reporter Gene: [srv-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCTCCAAACTGTTCGTGG] 3' and primer B 5' [GAGCGGGATTTTTAGGACATC] 3'.

4 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neuron of the amphid sensillum	amphid neuron	amphid sensory neuron	WBbt:0005394

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00005715	srv-4	F15E6.7	Caenorhabditis elegans

1 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023