WormMine: ExpressionPattern Expr6584

• Pattern: Adult Expression: Nervous System; amphids; amphid socket cells; Larval Expression: Nervous System; amphids; amphid socket cells
• Primary Identifier: Expr6584
• Remark: Also expressed in (comments from author) : ASJ amphid neuron (Hobert Lab 2005). Strain: BC13576
• Reporter Gene: [sru-19::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAAAATTCCACAAAAATATG] 3' and primer B 5' [GCAATTCCAACGAAAATTTGA] 3'.

4 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
Amphid socket cell, left	AMsoL	lineage name: ABplpaapapa	WBbt:0003931
Amphid socket cell, right	AMsoR	lineage name: ABprpaapapa	WBbt:0003929
neuron of the amphid sensillum	amphid neuron	amphid sensory neuron	WBbt:0005394

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00005682	sru-19	T04A11.8	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023