WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulva other; Primary Identifier  Expr6555
Remark  Also expressed in (comments from author) : Strain not available. Strain: BC13142 Reporter Gene  [T01A4.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGGTCATCGAGAGGGAAAC] 3' and primer B 5' [CGCTTAGAATGATTCGGATACC] 3'.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00020131 gcy-28 T01A4.1 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041