|
Picture: Figure 1. |
|
Expr8361
|
GFP expression initiated in the early gastrula. Robust expression of Prncs-1::GFP was observed in the midgut (E cell lineage) starting at the 28-cell stage and continuing into adulthood. By the comma stage, fluorescence was also visible in the embryo periphery in cells that give rise to hypodermis. In L1 larva and subsequent stages, strong expression of GFP was seen in hypodermal cells, including Hyp 7 syncytium and head and tail hypodermis. The expression pattern was identical in hermaphrodites and males, but adult hermaphrodites displayed fluorescence in vulval epithelium. Expression was absent in seam cells, nervous system, and pharynx. The Prncs-1::GFP reporter showed increased expression during starvation. Although fluorescence intensity was enhanced under starved conditions, the spatial expression pattern was unchanged. Expression of the Prncs-1::GFP transgene was also enhanced in males. An ~2.5-fold increase in rncs-1 expression in total RNA prepared from wild-type, well fed males, compared with hermaphrodites. |
|
|
Picture: Figure S2. |
|
Expr4898
|
SRP-6::GFP was expressed in the socket cells, the pharyngeal-intestinal valve, vulval hypoderm, the spermatheca and spermathecal-uterine junction and the intestine. Corresponding expression was seen in the srp-6::lacZ fusions. |
|
|
Picture: Fig. 4. |
|
Expr4889
|
pQC106, with the 3.0 kb promoter, showed expression in the same cells as pQC105 and also in rectal cells, vulva cells, the spermatheca-uterine valve and in body wall muscle cells and neurons of the ventral nerve cord. |
|
|
Picture: Figure 2. Similar DTC expression of GFP was observed in two other independently derived 6-kb pat-2 promoter fusion lines as well as with shorter promoter fusions of 3, 2, and <0.5 kb of pat-2 upstream sequence. To verify that this pattern is an accurate representation of PAT-2 expression, a translational fusion line with GFP inserted near the end of the cytoplasmic tail was examined. The PAT-2::GFP expression pattern was the same as the transcriptional fusions, including the up-regulation of expression in the DTC during L3. |
|
Expr4872
|
In each line, the pat-2p::GFP nematodes had high levels of GFP expression in body-wall muscle cells and vulval tissue. No GFP was detected in the DTCs migrating on the ventral ECM during L2. GFP was visible in DTCs during L3, when the DTC migrates from the ventral to dorsal surface, and was maintained in the DTC throughout adulthood. |
|
|
Picture: Fig. 10, C. |
|
Expr4822
|
The hex-2::gfp construct appeared to be active in the hypodermal cells, vulval toroids, and various adult head and tail neurons, Expressed throughout the life-cycle. |
|
|
Picture: Fig. 10, J and K. |
|
Expr4825
|
Expression of hex-5 was restricted to certain cells at the 3-fold stage but was also present in the vulval, head (muscle), and tail regions in larval and adult worms. Expressed throughout the life-cycle. |
|
|
Picture: Figure 7, C and D. |
|
Expr4813
|
Expression was observed throughout development, starting at midembryogenesis. VHA-5 was also detected at the lumen of the vulva and rectum. In addition, authors found VHA-5 expressed in the sheath cells associated with head and tail sensory organs. Three-dimensional reconstructions showed that VHA-5 and RDY-2 formed a sixfold symmetrical pattern, which includes a larger spot that presumably corresponds to the amphid. |
In the amphid sheath cell, VHA-5 was found in the most distal part of the cell lining the sheath pocket, which can be equated to its apical side. |
|
|
|
Expr4764
|
CO3H5.2 gene has a broad expression pattern. This includes expression in the pharynx and pharyngeal gland cells, seam cells, spermatheca, stomatointestinal muscle, vulva and body wall muscle. |
|
|
|
|
Expr4712
|
In young adult hermaphrodites, spas-1 was expressed in the whole bodies, particularly intestine, gonad, and vulva. |
|
|
|
|
Expr4984
|
By in situ hybridization, the remaining gene, F44A2.3, is reported to show weak but specific expression at the vulva and in the head. |
|
|
Picture: Figure 4a-i. |
|
Expr4983
|
High levels of constitutive GFP expression was observed in the pre-anal, vulval, hypodermal, glial amphid socket and excretory duct cells of the adult animal. |
|
|
Picture: Fig. 2. |
|
Expr4954
|
In larvae and adults, the circumferential filamentous pattern did not persist, but expression was seen in a subset of head and tail socket cells, the vulva, more faintly the uterus, and the rectum. |
GFP expression was observed in the epidermis from the 1.2-fold stage of elongation to the end of embryogenesis. The GFP formed a circumferential filamentous pattern that was spatially and temporally strikingly reminiscent of the circumferential actin microfilament pattern. Indeed, actin staining in a strain expressing the RGA-2::GFP construct showed that the two networks coincide. |
|
Picture: Fig. 5, Fig 6. |
|
Expr4956
|
NAB-1::GFP expression is restricted to epithelia and neurons. The earliest expression was observed in the hypodermis of 2-fold-stage early embryos. Immediately prior to hatching, this expression became restricted to the epithelial excretory canal and the nervous system, including the central nervous system and the motoneurons (dorsal and ventral nerve cords. In L3 and L4 larvae, NAB-1::GFP also localized transiently at the membranes of the developing vulva epithelia. Also expressed in distal tip cell (pers. comm. from Wesley Hung 11-17-07.) |
NAB-1::GFP puncta partially co-localized with the synaptic-vesicle protein SNT-1 and the active-zone protein UNC-10, suggesting that NAB-1 is present in presynaptic regions that are associated with vesicle pools and active zones. Similar to NAB-1, SAD-1 also showed co-localization with SNT-1. NAB-1::GFP and SAD-1 also showed partial co-localization, where each NAB-1::GFP punctum was associated with SAD-1 staining. |
|
No detailed description on life stages. |
|
Expr4379
|
ZK795.3::GFP expression pattern includes spermatheca, hypodermal cells, pharynx and the excretory cell and channels. In the L3 stage, expression was seen in the vulva, and in P6.p descendants. |
|
|
|
|
Expr4336
|
Expressed in head neurons (anterior deirid, cephalic sensilla) and vulva. |
|
|
No obvious difference in expression was observed between this particular mir-84::gfp fusion gene and one in which 8.1 kb of sequence upstream of mir-84 was fused to yellow fluorescent protein, kindly provided by A. Yoo and I. Greenwald. |
|
Expr4327
|
Transgenic mgEx674[mir-84::gfp] animals expressed GFP in the lateral hypodermal seam cells and other cells. The mir-84::gfp reporter was expressed in seam cells during early larval stages in some transgenic animals, although expression was more prevalent in L3-stage and older animals. |
|
|
No GO_term assigned. |
|
Expr4294
|
Expression of GFP-UNC-78 was detected in the pharynx, body wall muscle, spermatheca, and vulva. |
The GFP-UNC-78 fusion protein localized in a striated pattern in live animals. |
|
|
|
Expr4271
|
Anti-MIG-22 stained DTCs and the proximal arms of the gonad in a punctate pattern. Strong signals were detected in oocytes in adult gonads. MIG-22 was also detected in the developing vulval epithelium and seam cells. All these signals were significantly lower in mig-22(tk24) animals. |
|
|
|
|
Expr4266
|
Reporter genes that begin at -3190, -2021, -1248, and -517 bp upstream of the ATG of this alternate first exon 1 were expressed in body wall muscle cells, neurons in the head, nerve ring, ventral and dorsal nerve cords, neurons, and some epidermal cells in the tail. Weaker expression was also observed in pharyngeal muscles. The expression from promoter 2 started in the embryos at the 1.5-fold stage and was continuous throughout development. Expression from this internal promoter element is observed in vulval cells at the L4 stage and in adult hermaphrodites, including the uterine vulval cells uv1, 2, 3, and surrounding epithelium. |
|
|
Moreover, neither the dgn-1::GFP promoter reporter nor the rescuing DGN-1::GFP fusion show expression in muscle. Plasmid pJJ516 was made by inserting GFP from pPD114.38 into the HindIII site near the end of the dgn-1 coding sequence. The product contains GFP inserted after residue 575 of DGN-1, with the final seven DGN-1 residues at the C terminus. Expression of DGN-1::GFP is identical to that of the dgn-1::GFP promoter reporter, and DGN-1::GFP rescues the sterility of dgn-1(cg121). |
|
Expr4218
|
In early (pre-morphological) embryos, dgn-1::GFP expression is evident in many epithelial and neural precursors comprising the outer layer of cells. As elongation begins at comma stage, expression becomes most prominent in several specialized epithelial cells, including pharyngeal e2 and marginal cells, excretory cells, the somatic gonad precursors (SGPs) Z1 and Z4, and rectal epithelial cells. Weaker expression is apparent in hypodermal precursors and neuroblasts along the ventral midline. Pharyngeal expression persists through the L3 larval stage, whereas excretory and rectal cell expression persists throughout development. SGP expression persists in SGP descendants, such as the distal tip cells (DTCs), and increases throughout the gonad during the L4 stage. Variable, generally weak expression is seen throughout larval development in several neurons, although PVP neurons show strong expression throughout development. Transient increased expression occurs in new P cell-derived neurons in the ventral nerve cord in late L1/early L2 stage animals. Variable weak expression is seen in hypodermal cells, principally hyp5 in the head. Preceding the L4/adult molt, expression increases in the vulval epithelium. |
|
|
|
|
Expr4593
|
Transgenic animals expressing GFP under the control of the zfp-2 promoter showed fluorescence in vulval cells and all somatic gonad structures such as spermatheca, sheath cells, uterine cells and distal tip cells (DTCs). |
|
|
|
|
Expr4567
|
Expression of fshr-1 mRNA was observed in a number of somatic tissues, with the strongest expression occurring in the intestine. No expression of fshr-1 was detected in the germline when authors used probes to three different regions of the gene. |
|
|
|
|
Expr4646
|
Expression of TRPA-1:: GFP fusion proteins was observed in several cell types. In lines carrying the short fusion construct (for example, ljEx107), TRPA-1:: GFP fusion protein was localized to many tissues, including pharyngeal muscle and body wall muscle, the excretory system, the rectal gland cell, vulval epithelium, epithelial cells in the head, and the spermatheca. Sporadic expression was also observed in some head neurons with this construct. |
|
|
|
|
Expr4647
|
Transgenic lines generated with the partial protein fusion construct (for example, ljEx109) expressed TRPA-1:: GFP in the same cells as ljEx107 (see Expr4646), but with some additional cells, including the majority of amphid sensory neurons (for example, ASH, AWA, AWB, ASI and ASK) and the phasmid neurons PHA and PHB. |
|
|
|
|
Expr4648
|
Transgenic lines generated with the full-length protein fusion construct (for example, ljEx114) expressed TRPA-1:: GFP in the same cells as ljEx107 (see Expr4646), but with some additional cells, including the majority of amphid sensory neurons (for example, ASH, AWA, AWB, ASI and ASK) and the phasmid neurons PHA and PHB. The full-length TRPA-1:: GFP fusion was also expressed in the PVD and PDE in the postdeirid sensilla and the sensory neurons OLQ and IL1. Other neurons in the head and ventral nerve cord also expressed TRPA-1:: GFP. |
The fusion protein was observed at the cilia of sensory neurons, as well as at the cell body. |
|
Reporter gene fusion type not specified. |
|
Expr4605
|
The GFP construct was broadly expressed throughout the animal with fluorescence strongest in the seam cells, body wall and pharyngeal muscle, vulval cells, spermatheca, the tail, and many neurons. |
|
|
|
For dre-1::gfp, a 4 kb promoter was amplified with primers 5' -GGTACCCGAGGGGACATCGAGATAG-3' and 5' -GGTACCTTCCTGGCCAACCAGAGAC-3' and was cloned into Fire vector L3781 (BA 279). The dre-1 ORF and the dre-1 3' UTR region were amplified with primers 5' -GCTAGCATGTCGTCCTCTTCGTCAC-3' and 5' -ACTAGTTACTTACTCCACTCCACACAG-3' and were cloned into BA279 (BA280). Lines containing this construct included dhEx346 and dhIs442. To obtain the full-length promoter construct, authors substituted the promoter from BA279 with a 12.3 kb promoter by using primers 5' -GCGGCCGCGTTGCACACAAAACATTATTATTTTCTTTCTCTT-3' and 5' -TACGTATCTCGTCCCTGAGATCTCTCATTT-3' (BA508). Resulting lines containing this array included dhEx443 and dhEx452. --precise ends. |
Expr4547
|
First detected by midembryogenesis, expression was most prominent in epidermal and intestinal cells. By the 1.5-fold stage of embryogenesis, expression was additionally detected in neurons and other cells. During larval and adult stages, DRE-1::GFP was most visible in epidermal seam cells and hypodermis. Expression was high in larvae and low in adults. In addition, DRE-1 was strongly expressed in the P epidermal blast cells and descendents that give rise to the vulva. Weak expression was seen in the somatic gonad, including the gonadoblasts, the anchor cell, dtcs, and occasionally adult spermatheca and uterus. Notably, with another construct (dhEx346, 4 kb promoter, 4 kb coding region), dtc expression was stronger and commenced by mid-L3. In the musculature, DRE-1 was seen in the pharynx, anal depressor, sex muscles, and body wall muscles. Finally, DRE-1 was detected in neurons of the head, tail, ventral cord, and periphery. |
Generally, DRE-1::GFP was localized to both the nucleus and cytoplasm, and it was broadly expressed, including in phenotypically affected tissues. |
|
|
|
Expr4502
|
A transcriptional reporter for sel-2 in which the 5' upstream region drives nuclearly localized YFP is expressed in the VPCs and their descendants, as well as in many other cell types, including the epithelial cells of the intestine and the rectum, the seam cells, many cells in the head and the tail, and the cells of the ventral nerve cord. |
|
|
Also expressed in (comments from author) : Neural in tail are the PHASMID GLIA i.e. socket cells (Hall Lab, 2005). Strain: BC13998 |
[C17H11.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTATTAAAAATGTTTGCGCCG] 3' and primer B 5' [CGTCGCTGTATGACCAACC] 3'. |
Expr5292
|
Adult Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; Reproductive System; uterus; vulva other; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal epithelium; hypodermis; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ; |
|
|
Strain: BC13462 |
[nas-37::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAATATTGTAGGAGGCAAGTCG] 3' and primer B 5' [TGCAAAATAGAACATCAAGAATCG] 3'. |
Expr5287
|
Adult Expression: rectal epithelium; Reproductive System; vulva other; seam cells; Larval Expression: rectal epithelium; hypodermis; seam cells; |
|
