WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: hypodermis; Primary Identifier  Expr6619
Remark  Also expressed in (comments from author) : did not detect GFP expression after L1 stage. Strain: BC14357 Reporter Gene  [T05H10.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACATCGTTCATTTGAGAAGTTTGA] 3' and primer B 5' [GATGACGGCTGACACAGAGA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00011508 mtre-1 T05H10.3 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023