WormMine: ExpressionPattern Expr6784

• Pattern: Adult Expression: Nervous System; tail neurons; unidentified cells in tail
• Primary Identifier: Expr6784
• Remark: Also expressed in (comments from author) : Unsure if expression is in the larval stage. Only detected GFP in adult tails.Looked at the strain a year later, and saw no expression. Strain: BC11868
• Reporter Gene: [T27A8.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGACGGAGAAGGCTGG] 3' and primer B 5' [ATACGTGATGGTAGCTGAAAATGA] 3'.

3 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
posterior region, from rectum to the end	tail		WBbt:0005741

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00012074	T27A8.2	T27A8.2	Caenorhabditis elegans

1 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041